Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2545351..2545574 | Replicon | chromosome |
| Accession | NZ_CP109611 | ||
| Organism | Enterococcus faecalis strain AFL-109F | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | OGM83_RS12405 | Protein ID | WP_021164442.1 |
| Coordinates | 2545473..2545574 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2545351..2545536 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| OGM83_RS12380 (2540968) | 2540968..2541921 | - | 954 | WP_271232295.1 | siderophore ABC transporter substrate-binding protein | - |
| OGM83_RS12385 (2541960) | 2541960..2542715 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| OGM83_RS12390 (2542712) | 2542712..2543677 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| OGM83_RS12395 (2543674) | 2543674..2544621 | - | 948 | WP_002368428.1 | iron chelate uptake ABC transporter family permease subunit | - |
| OGM83_RS12400 (2544806) | 2544806..2545258 | + | 453 | WP_002359057.1 | YueI family protein | - |
| - (2545314) | 2545314..2545519 | + | 206 | NuclAT_7 | - | - |
| - (2545351) | 2545351..2545536 | + | 186 | NuclAT_5 | - | Antitoxin |
| OGM83_RS12405 (2545473) | 2545473..2545574 | - | 102 | WP_021164442.1 | putative holin-like toxin | Toxin |
| - (2545749) | 2545749..2545958 | + | 210 | NuclAT_6 | - | - |
| - (2545783) | 2545783..2545962 | + | 180 | NuclAT_4 | - | - |
| OGM83_RS12410 (2545907) | 2545907..2546008 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
| OGM83_RS12415 (2546197) | 2546197..2548467 | - | 2271 | WP_002368430.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| OGM83_RS12420 (2548638) | 2548638..2549138 | + | 501 | WP_002354954.1 | cysteine hydrolase family protein | - |
| OGM83_RS12425 (2549484) | 2549484..2550380 | + | 897 | WP_002365354.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3625.38 Da Isoelectric Point: 4.5869
>T261927 WP_021164442.1 NZ_CP109611:c2545574-2545473 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFGILEATKNDKK
MSIEATLELMISFATLVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 186 bp
>AT261927 NZ_CP109611:2545351-2545536 [Enterococcus faecalis]
AAAAGAGAGGTATGCGGGTACATACCTCTCCTTTATACCAACGCCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTT
TTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGTTATTTTTTATCATTTTTCGTTGCTTCAAGGATACCGA
AAATCAGTAACGCAACAAGGGTTGCA
AAAAGAGAGGTATGCGGGTACATACCTCTCCTTTATACCAACGCCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTT
TTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGTTATTTTTTATCATTTTTCGTTGCTTCAAGGATACCGA
AAATCAGTAACGCAACAAGGGTTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|