Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | hok-sok/- |
| Location | 99002..99427 | Replicon | plasmid p1 |
| Accession | NZ_CP104534 | ||
| Organism | Escherichia coli strain E10 | ||
Toxin (Protein)
| Gene name | hok | Uniprot ID | - |
| Locus tag | N5O77_RS25640 | Protein ID | WP_223195199.1 |
| Coordinates | 99002..99124 (-) | Length | 41 a.a. |
Antitoxin (RNA)
| Gene name | srnC | ||
| Locus tag | - | ||
| Coordinates | 99216..99427 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| N5O77_RS25605 (94076) | 94076..94303 | - | 228 | WP_001442099.1 | conjugal transfer relaxosome protein TraY | - |
| N5O77_RS25610 (94397) | 94397..95083 | - | 687 | WP_000332490.1 | PAS domain-containing protein | - |
| N5O77_RS25615 (95273) | 95273..95656 | - | 384 | WP_000124981.1 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| N5O77_RS25620 (95978) | 95978..96580 | + | 603 | Protein_99 | transglycosylase SLT domain-containing protein | - |
| N5O77_RS25625 (96876) | 96876..97697 | - | 822 | WP_001234468.1 | DUF932 domain-containing protein | - |
| N5O77_RS25630 (97816) | 97816..98103 | - | 288 | Protein_101 | hypothetical protein | - |
| N5O77_RS25635 (98404) | 98404..98701 | + | 298 | Protein_102 | hypothetical protein | - |
| N5O77_RS25640 (99002) | 99002..99124 | - | 123 | WP_223195199.1 | Hok/Gef family protein | Toxin |
| N5O77_RS25645 (99069) | 99069..99182 | - | 114 | Protein_104 | DUF5431 family protein | - |
| - (99216) | 99216..99427 | - | 212 | NuclAT_0 | - | Antitoxin |
| - (99216) | 99216..99427 | - | 212 | NuclAT_0 | - | Antitoxin |
| - (99216) | 99216..99427 | - | 212 | NuclAT_0 | - | Antitoxin |
| - (99216) | 99216..99427 | - | 212 | NuclAT_0 | - | Antitoxin |
| N5O77_RS25650 (99372) | 99372..100158 | - | 787 | Protein_105 | plasmid SOS inhibition protein A | - |
| N5O77_RS25655 (100155) | 100155..100589 | - | 435 | WP_076838612.1 | conjugation system SOS inhibitor PsiB | - |
| N5O77_RS25660 (100644) | 100644..102602 | - | 1959 | WP_102596223.1 | ParB/RepB/Spo0J family partition protein | - |
| N5O77_RS25665 (102666) | 102666..102899 | - | 234 | WP_001553739.1 | DUF905 family protein | - |
| N5O77_RS25670 (102957) | 102957..103496 | - | 540 | WP_009426937.1 | single-stranded DNA-binding protein | - |
| N5O77_RS25675 (103797) | 103797..104222 | + | 426 | WP_147706105.1 | hypothetical protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Conjugative plasmid | sitABCD | iroB / iroC / iroD / iroE / iroN / vat / iutA / iucD / iucC / iucB / iucA | 1..133669 | 133669 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 41 a.a. Molecular weight: 4536.35 Da Isoelectric Point: 8.2691
>T258344 WP_223195199.1 NZ_CP104534:c99124-99002 [Escherichia coli]
IVCCTLLIFTLLTRNRLCEVRLKDGYREVTASLAYESSGK
IVCCTLLIFTLLTRNRLCEVRLKDGYREVTASLAYESSGK
Download Length: 123 bp
Antitoxin
Download Length: 212 bp
>AT258344 NZ_CP104534:c99427-99216 [Escherichia coli]
TCACACGGATTACCCGTGAACTGGTTGAACGACCAGATTATTTTCAGGGAAAGTGAGTGTGGTCAGCGTGCAGGGATATG
AGCTATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAAGGTGGTTTGTTACCGTGTTGTGTGGCAGAAGGC
AGAAAGCCCCGTAGTTAATTTTTCATTAACCCACGAGGCCCCCTGTATGTCT
TCACACGGATTACCCGTGAACTGGTTGAACGACCAGATTATTTTCAGGGAAAGTGAGTGTGGTCAGCGTGCAGGGATATG
AGCTATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAAGGTGGTTTGTTACCGTGTTGTGTGGCAGAAGGC
AGAAAGCCCCGTAGTTAATTTTTCATTAACCCACGAGGCCCCCTGTATGTCT
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
