Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 892963..893222 | Replicon | chromosome |
| Accession | NZ_CP103863 | ||
| Organism | Enterococcus faecalis strain SJ82 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | NYR15_RS04440 | Protein ID | WP_075551663.1 |
| Coordinates | 893121..893222 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 892963..893172 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NYR15_RS04410 | 888213..889166 | - | 954 | WP_002354964.1 | siderophore ABC transporter substrate-binding protein | - |
| NYR15_RS04415 | 889205..889960 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| NYR15_RS04420 | 889957..890922 | - | 966 | WP_002354961.1 | iron chelate uptake ABC transporter family permease subunit | - |
| NYR15_RS04425 | 890919..891866 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| NYR15_RS04430 | 892051..892503 | + | 453 | WP_002354958.1 | YueI family protein | - |
| NYR15_RS04435 | 892688..892789 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
| - | 892963..893172 | + | 210 | - | - | Antitoxin |
| NYR15_RS04440 | 893121..893222 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
| NYR15_RS04445 | 893412..895682 | - | 2271 | WP_002392683.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| NYR15_RS04450 | 895853..896353 | + | 501 | WP_002354954.1 | cysteine hydrolase family protein | - |
| NYR15_RS04455 | 896900..897796 | + | 897 | WP_002354953.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T256832 WP_075551663.1 NZ_CP103863:c893222-893121 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 210 bp
>AT256832 NZ_CP103863:892963-893172 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|