Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2640592..2640852 | Replicon | chromosome |
Accession | NZ_CP102070 | ||
Organism | Enterococcus faecalis strain JF3A-4253 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | NP948_RS13005 | Protein ID | WP_075551663.1 |
Coordinates | 2640751..2640852 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2640592..2640802 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NP948_RS12980 (2636276) | 2636276..2637229 | - | 954 | WP_002359060.1 | siderophore ABC transporter substrate-binding protein | - |
NP948_RS12985 (2637268) | 2637268..2638023 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
NP948_RS12990 (2638020) | 2638020..2638985 | - | 966 | WP_002354961.1 | iron chelate uptake ABC transporter family permease subunit | - |
NP948_RS12995 (2638982) | 2638982..2639929 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
NP948_RS13000 (2640114) | 2640114..2640566 | + | 453 | WP_010710887.1 | YueI family protein | - |
- (2640592) | 2640592..2640802 | + | 211 | NuclAT_3 | - | Antitoxin |
- (2640629) | 2640629..2640806 | + | 178 | NuclAT_11 | - | - |
NP948_RS13005 (2640751) | 2640751..2640852 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
NP948_RS13010 (2641041) | 2641041..2643311 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
NP948_RS13015 (2643482) | 2643482..2643982 | + | 501 | WP_016627679.1 | cysteine hydrolase family protein | - |
NP948_RS13020 (2644434) | 2644434..2645330 | + | 897 | WP_002354953.1 | YitT family protein | - |
NP948_RS13025 (2645381) | 2645381..2645779 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T253125 WP_075551663.1 NZ_CP102070:c2640852-2640751 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 211 bp
>AT253125 NZ_CP102070:2640592-2640802 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCG
CCAGTTATAAGAACTGGTGGATTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCG
CCAGTTATAAGAACTGGTGGATTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|