Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 508305..508537 | Replicon | chromosome |
Accession | NZ_CP102070 | ||
Organism | Enterococcus faecalis strain JF3A-4253 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | C7CXQ5 |
Locus tag | NP948_RS02600 | Protein ID | WP_002355568.1 |
Coordinates | 508305..508421 (+) | Length | 39 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 508332..508537 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NP948_RS02590 (503743) | 503743..506001 | + | 2259 | WP_002364805.1 | DNA helicase PcrA | - |
NP948_RS02595 (506127) | 506127..508157 | + | 2031 | WP_104806903.1 | NAD-dependent DNA ligase LigA | - |
NP948_RS02600 (508305) | 508305..508421 | + | 117 | WP_002355568.1 | putative holin-like toxin | Toxin |
- (508332) | 508332..508537 | - | 206 | NuclAT_2 | - | Antitoxin |
NP948_RS02605 (508739) | 508739..509044 | + | 306 | WP_109537637.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC | - |
NP948_RS02610 (509044) | 509044..510513 | + | 1470 | WP_002398120.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA | - |
NP948_RS02615 (510513) | 510513..511943 | + | 1431 | WP_016627698.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB | - |
NP948_RS02620 (511962) | 511962..513050 | + | 1089 | WP_002355572.1 | diacylglycerol kinase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 39 a.a. Molecular weight: 4065.93 Da Isoelectric Point: 5.9482
>T253121 WP_002355568.1 NZ_CP102070:508305-508421 [Enterococcus faecalis]
MFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
MFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
Download Length: 117 bp
Antitoxin
Download Length: 206 bp
>AT253121 NZ_CP102070:c508537-508332 [Enterococcus faecalis]
AAAAGAGAGATATGCAGGAACATACCTCTCTAGTAGCCACTACTAGTTATAAGAACTAGCGGCTTACTGAGTTATTGGTT
TTATTTCAAACGCTTAACCGTTCAGCTCGTCAAAGCTTATGAACGGTTATTTTTGTTGTCTAAGACAAGCGCTAAGATAC
CGAAGATAATGGTCACAACAAGTGTTGCAAAACCAATCATCAGTCC
AAAAGAGAGATATGCAGGAACATACCTCTCTAGTAGCCACTACTAGTTATAAGAACTAGCGGCTTACTGAGTTATTGGTT
TTATTTCAAACGCTTAACCGTTCAGCTCGTCAAAGCTTATGAACGGTTATTTTTGTTGTCTAAGACAAGCGCTAAGATAC
CGAAGATAATGGTCACAACAAGTGTTGCAAAACCAATCATCAGTCC
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|