Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2554978..2555202 | Replicon | chromosome |
Accession | NZ_CP102065 | ||
Organism | Enterococcus faecalis strain JF3A-223 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | NP947_RS12500 | Protein ID | WP_224561205.1 |
Coordinates | 2555101..2555202 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2554978..2555156 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NP947_RS12475 | 2550625..2551578 | - | 954 | WP_256969819.1 | siderophore ABC transporter substrate-binding protein | - |
NP947_RS12480 | 2551617..2552372 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
NP947_RS12485 | 2552369..2553334 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
NP947_RS12490 | 2553331..2554278 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
NP947_RS12495 | 2554463..2554915 | + | 453 | WP_002378807.1 | YueI family protein | - |
- | 2554978..2555156 | + | 179 | - | - | Antitoxin |
NP947_RS12500 | 2555101..2555202 | - | 102 | WP_224561205.1 | putative holin-like toxin | Toxin |
NP947_RS12505 | 2555393..2557663 | - | 2271 | WP_078122760.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
NP947_RS12510 | 2557834..2558340 | + | 507 | WP_002378810.1 | cysteine hydrolase family protein | - |
NP947_RS12515 | 2558530..2559426 | + | 897 | WP_002365354.1 | YitT family protein | - |
NP947_RS12520 | 2559477..2559875 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3629.37 Da Isoelectric Point: 4.5869
>T253110 WP_224561205.1 NZ_CP102065:c2555202-2555101 [Enterococcus faecalis]
MSIEATLELMISFAAFVALLIFGILEATKNDKK
MSIEATLELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 179 bp
>AT253110 NZ_CP102065:2554978-2555156 [Enterococcus faecalis]
AAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTT
TTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCG
AAAATCAGTAGTGCAACAA
AAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTT
TTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCG
AAAATCAGTAGTGCAACAA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|