Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | hok-sok/- |
| Location | 117629..118054 | Replicon | plasmid pEC21Z014-165K |
| Accession | NZ_CP101275 | ||
| Organism | Escherichia coli strain EC21Z-014 | ||
Toxin (Protein)
| Gene name | hok | Uniprot ID | - |
| Locus tag | NML17_RS24480 | Protein ID | WP_227898123.1 |
| Coordinates | 117629..117748 (-) | Length | 40 a.a. |
Antitoxin (RNA)
| Gene name | srnC | ||
| Locus tag | - | ||
| Coordinates | 117843..118054 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NML17_RS24445 (112976) | 112976..113203 | - | 228 | WP_001254386.1 | conjugal transfer relaxosome protein TraY | - |
| NML17_RS24450 (113297) | 113297..113983 | - | 687 | WP_001825184.1 | PAS domain-containing protein | - |
| NML17_RS24455 (114174) | 114174..114557 | - | 384 | WP_000124981.1 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| NML17_RS24460 (114834) | 114834..115481 | + | 648 | WP_001825185.1 | transglycosylase SLT domain-containing protein | - |
| NML17_RS24465 (115778) | 115778..116599 | - | 822 | WP_001234469.1 | DUF932 domain-containing protein | - |
| NML17_RS24470 (116718) | 116718..117005 | - | 288 | WP_000107542.1 | hypothetical protein | - |
| NML17_RS24475 (117007) | 117007..117328 | + | 322 | Protein_125 | hypothetical protein | - |
| NML17_RS24480 (117629) | 117629..117748 | - | 120 | WP_227898123.1 | Hok/Gef family protein | Toxin |
| NML17_RS24485 (117696) | 117696..117809 | - | 114 | Protein_127 | DUF5431 family protein | - |
| - (117843) | 117843..118054 | - | 212 | NuclAT_0 | - | Antitoxin |
| - (117843) | 117843..118054 | - | 212 | NuclAT_0 | - | Antitoxin |
| - (117843) | 117843..118054 | - | 212 | NuclAT_0 | - | Antitoxin |
| - (117843) | 117843..118054 | - | 212 | NuclAT_0 | - | Antitoxin |
| NML17_RS24490 (118065) | 118065..118784 | - | 720 | WP_001276275.1 | plasmid SOS inhibition protein A | - |
| NML17_RS24495 (118781) | 118781..119215 | - | 435 | WP_000845935.1 | conjugation system SOS inhibitor PsiB | - |
| NML17_RS24500 (119270) | 119270..121228 | - | 1959 | Protein_130 | ParB/RepB/Spo0J family partition protein | - |
| NML17_RS24505 (121287) | 121287..121520 | - | 234 | WP_001209608.1 | DUF905 domain-containing protein | - |
| NML17_RS24510 (121583) | 121583..122080 | - | 498 | WP_050427786.1 | single-stranded DNA-binding protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Conjugative plasmid | sitABCD | iutA / iucD / iucC / iucB / iucA | 1..164754 | 164754 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 40 a.a. Molecular weight: 4423.19 Da Isoelectric Point: 8.2691
>T251781 WP_227898123.1 NZ_CP101275:c117748-117629 [Escherichia coli]
VCCTLLIFTLLTRNRLCEVRLKDGYREVTASLAYESSGK
VCCTLLIFTLLTRNRLCEVRLKDGYREVTASLAYESSGK
Download Length: 120 bp
Antitoxin
Download Length: 212 bp
>AT251781 NZ_CP101275:c118054-117843 [Escherichia coli]
TCACACGGATTTCCCGTGAACGGTCTGAATGAGCGGATTCTTTTCAGGAAAAGTGAGTGTGGTCAGCGTGCAGGGATATG
AGCTATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAAGGTGGTTTGTTACCGTGTTGTGTGGCAGAAGGC
AGAAAGCCCCGTAGTTAATTTTTCATTAACCCACGAGGCCCCCTGTATGTCT
TCACACGGATTTCCCGTGAACGGTCTGAATGAGCGGATTCTTTTCAGGAAAAGTGAGTGTGGTCAGCGTGCAGGGATATG
AGCTATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAAGGTGGTTTGTTACCGTGTTGTGTGGCAGAAGGC
AGAAAGCCCCGTAGTTAATTTTTCATTAACCCACGAGGCCCCCTGTATGTCT
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
