Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2590228..2590489 | Replicon | chromosome |
| Accession | NZ_CP100596 | ||
| Organism | Enterococcus faecalis strain Chr-JH 2-2 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | NLG43_RS12690 | Protein ID | WP_224561205.1 |
| Coordinates | 2590388..2590489 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2590228..2590439 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NLG43_RS12665 | 2585912..2586865 | - | 954 | WP_002359060.1 | siderophore ABC transporter substrate-binding protein | - |
| NLG43_RS12670 | 2586904..2587659 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| NLG43_RS12675 | 2587656..2588621 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| NLG43_RS12680 | 2588618..2589565 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| NLG43_RS12685 | 2589750..2590202 | + | 453 | WP_002378807.1 | YueI family protein | - |
| - | 2590228..2590439 | + | 212 | - | - | Antitoxin |
| NLG43_RS12690 | 2590388..2590489 | - | 102 | WP_224561205.1 | putative holin-like toxin | Toxin |
| NLG43_RS12695 | 2590680..2592950 | - | 2271 | WP_002378809.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| NLG43_RS12700 | 2593121..2593627 | + | 507 | WP_002378810.1 | cysteine hydrolase family protein | - |
| NLG43_RS12705 | 2593817..2594713 | + | 897 | WP_002365354.1 | YitT family protein | - |
| NLG43_RS12710 | 2594764..2595162 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3629.37 Da Isoelectric Point: 4.5869
>T250858 WP_224561205.1 NZ_CP100596:c2590489-2590388 [Enterococcus faecalis]
MSIEATLELMISFAAFVALLIFGILEATKNDKK
MSIEATLELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 212 bp
>AT250858 NZ_CP100596:2590228-2590439 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGG
TTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGG
TTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|