Detailed information of TA system TA249341

Bioinformatically predicted

Overview

TA module

• Type: I
• Classification (family/domain): hok-sok/-
• Location: 153764..154189
• Replicon: plasmid pGDE043-2
• Accession: NZ_CP099723
• Organism: Escherichia coli strain EC21GDE043

Toxin (Protein)

• Gene name: hok
• Uniprot ID: -
• Locus tag: NH569_RS26370
• Protein ID: WP_227898123.1
• Coordinates: 153764..153883 (-)
• Length: 40 a.a.

Antitoxin (RNA)

Gene name	srnC
Locus tag	-
Coordinates	153978..154189 (-)

Genomic Context

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
NH569_RS26335 (149114)	149114..149341	-	228	WP_001442099.1	conjugal transfer relaxosome protein TraY	-
NH569_RS26340 (149435)	149435..150121	-	687	WP_139499137.1	PAS domain-containing protein	-
NH569_RS26345 (150311)	150311..150694	-	384	WP_000124981.1	conjugal transfer relaxosome DNA-binding protein TraM	-
NH569_RS26350 (151028)	151028..151618	+	591	WP_000252676.1	transglycosylase SLT domain-containing protein	-
NH569_RS26355 (151914)	151914..152735	-	822	WP_001234485.1	DUF932 domain-containing protein	-
NH569_RS26360 (152854)	152854..153140	-	287	Protein_165	hypothetical protein	-
NH569_RS26365 (153142)	153142..153463	+	322	Protein_166	hypothetical protein	-
NH569_RS26370 (153764)	153764..153883	-	120	WP_227898123.1	Hok/Gef family protein	Toxin
NH569_RS26375 (153831)	153831..153944	-	114	Protein_168	DUF5431 family protein	-
- (153978)	153978..154189	-	212	NuclAT_0	-	Antitoxin
- (153978)	153978..154189	-	212	NuclAT_0	-	Antitoxin
- (153978)	153978..154189	-	212	NuclAT_0	-	Antitoxin
- (153978)	153978..154189	-	212	NuclAT_0	-	Antitoxin
NH569_RS26380 (154200)	154200..154919	-	720	WP_001276275.1	plasmid SOS inhibition protein A	-
NH569_RS26385 (154916)	154916..155350	-	435	WP_000845935.1	conjugation system SOS inhibitor PsiB	-
NH569_RS26390 (155405)	155405..157363	-	1959	Protein_171	ParB/RepB/Spo0J family partition protein	-
NH569_RS26395 (157422)	157422..157655	-	234	WP_001209608.1	DUF905 domain-containing protein	-
NH569_RS26400 (157718)	157718..158215	-	498	WP_050427786.1	single-stranded DNA-binding protein	-

Associated MGEs

MGE detail	Similar MGEs	Relative position	MGE Type	Cargo ARG	Virulence gene	Coordinates	Length (bp)
	-	inside	Conjugative plasmid	qnrS1 / blaLAP-2 / dfrA14 / ant(3'')-Ia / blaOXA-10 / cmlA1 / ARR-3 / sitABCD	iroB / iroC / iroD / iroE / iroN / vat / iutA / iucD / iucC / iucB / iucA	1..203860	203860
	-	flank	IS/Tn	-	-	159061..159564	503

Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.

Domains

Predicted by InterproScan

Toxin

• Hok/gef cell toxic protein (1-34)

Sequences

Toxin

Protein

• Length: 40 a.a.
• Molecular weight: 4423.19 Da
• Isoelectric Point: 8.2691

>T249341 WP_227898123.1 NZ_CP099723:c153883-153764 [Escherichia coli]
VCCTLLIFTLLTRNRLCEVRLKDGYREVTASLAYESSGK

Nucleotide

• Length: 120 bp

Antitoxin

Nucleotide

• Length: 212 bp

>AT249341 NZ_CP099723:c154189-153978 [Escherichia coli]
TCACACGGATTTCCCGTGAACGGTCTGAATGAGCGGATTCTTTTCAGGAAAAGTGAGTGTGGTCAGCGTGCAGGGATATG
AGCTATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAAGGTGGTTTGTTACCGTGTTGTGTGGCAGAAGGC
AGAAAGCCCCGTAGTTAATTTTTCATTAACCCACGAGGCCCCCTGTATGTCT

Structures

Antitoxin