Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | SprG2-MW1433/- |
Location | 1567395..1567620 | Replicon | chromosome |
Accession | NZ_CP099506 | ||
Organism | Staphylococcus aureus strain 0316-H-5A |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | LPT22_RS07715 | Protein ID | WP_000253687.1 |
Coordinates | 1567513..1567620 (-) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | MW1433 | ||
Locus tag | - | ||
Coordinates | 1567395..1567488 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LPT22_RS07680 (1562899) | 1562899..1563414 | - | 516 | WP_000163283.1 | type 1 glutamine amidotransferase domain-containing protein | - |
LPT22_RS07685 (1563544) | 1563544..1563705 | - | 162 | WP_001005407.1 | SE1561 family protein | - |
LPT22_RS07690 (1564052) | 1564052..1564132 | + | 81 | WP_100250272.1 | hypothetical protein | - |
LPT22_RS07695 (1564862) | 1564862..1565362 | + | 501 | WP_113559807.1 | hypothetical protein | - |
LPT22_RS07700 (1565452) | 1565452..1566897 | - | 1446 | WP_031886331.1 | SH3 domain-containing protein | - |
LPT22_RS07705 (1566878) | 1566878..1567315 | - | 438 | WP_031886332.1 | phage holin | - |
LPT22_RS07710 (1567366) | 1567366..1567473 | + | 108 | Protein_1479 | hypothetical protein | - |
- (1567395) | 1567395..1567488 | + | 94 | NuclAT_0 | - | Antitoxin |
- (1567395) | 1567395..1567488 | + | 94 | NuclAT_0 | - | Antitoxin |
- (1567395) | 1567395..1567488 | + | 94 | NuclAT_0 | - | Antitoxin |
- (1567395) | 1567395..1567488 | + | 94 | NuclAT_0 | - | Antitoxin |
LPT22_RS07715 (1567513) | 1567513..1567620 | - | 108 | WP_000253687.1 | putative holin-like toxin | Toxin |
LPT22_RS07720 (1567857) | 1567857..1568156 | - | 300 | WP_031886333.1 | DUF2951 domain-containing protein | - |
LPT22_RS07725 (1568205) | 1568205..1568354 | - | 150 | WP_162783876.1 | hypothetical protein | - |
LPT22_RS07730 (1568341) | 1568341..1570527 | - | 2187 | WP_031886334.1 | phage tail protein | - |
LPT22_RS07735 (1570543) | 1570543..1571658 | - | 1116 | WP_031886335.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1562899..1601401 | 38502 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3844.80 Da Isoelectric Point: 10.4997
>T249012 WP_000253687.1 NZ_CP099506:c1567620-1567513 [Staphylococcus aureus]
VVSIVDALNLMFSFGMFIVTLLGLVIAIVKLNHKK
VVSIVDALNLMFSFGMFIVTLLGLVIAIVKLNHKK
Download Length: 108 bp
Antitoxin
Download Length: 94 bp
>AT249012 NZ_CP099506:1567395-1567488 [Staphylococcus aureus]
ATAAATAGAAAAAGGGCAACATGCGGAAACATGTTACCCTAGTGAGCCCGTTAAAAAGACGGTGACCTCTTTTATATGAT
TAATAAATAACCAT
ATAAATAGAAAAAGGGCAACATGCGGAAACATGTTACCCTAGTGAGCCCGTTAAAAAGACGGTGACCTCTTTTATATGAT
TAATAAATAACCAT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|