Detailed information of TA system TA248563

Bioinformatically predicted

Overview

TA module

• Type: I
• Classification (family/domain): hok-sok/-
• Location: 54541..54965
• Replicon: plasmid unnamed1
• Accession: NZ_CP099345
• Organism: Escherichia marmotae strain RHB35-E2-C08

Toxin (Protein)

• Gene name: hok
• Uniprot ID: -
• Locus tag: NFK54_RS23950
• Protein ID: WP_223163518.1
• Coordinates: 54843..54965 (+)
• Length: 41 a.a.

Antitoxin (RNA)

Gene name	srnC
Locus tag	-
Coordinates	54541..54738 (+)

Genomic Context

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
NFK54_RS23910 (49795)	49795..50235	-	441	Protein_54	hypothetical protein	-
NFK54_RS23915 (50305)	50305..50511	+	207	WP_069894508.1	single-stranded DNA-binding protein	-
NFK54_RS23920 (50537)	50537..50992	+	456	WP_112021089.1	single-stranded DNA-binding protein	-
NFK54_RS23925 (51049)	51049..51282	+	234	WP_001470808.1	DUF905 domain-containing protein	-
NFK54_RS23930 (51346)	51346..53310	+	1965	WP_279283662.1	ParB/RepB/Spo0J family partition protein	-
NFK54_RS23935 (53379)	53379..53813	+	435	WP_279283663.1	conjugation system SOS inhibitor PsiB	-
NFK54_RS23940 (53810)	53810..54596	+	787	Protein_60	plasmid SOS inhibition protein A	-
- (54541)	54541..54738	+	198	NuclAT_0	-	Antitoxin
- (54541)	54541..54738	+	198	NuclAT_0	-	Antitoxin
- (54541)	54541..54738	+	198	NuclAT_0	-	Antitoxin
- (54541)	54541..54738	+	198	NuclAT_0	-	Antitoxin
NFK54_RS23945 (54746)	54746..54898	+	153	Protein_61	DUF5431 family protein	-
NFK54_RS23950 (54843)	54843..54965	+	123	WP_223163518.1	Hok/Gef family protein	Toxin
NFK54_RS23955 (55266)	55266..55562	-	297	Protein_63	hypothetical protein	-
NFK54_RS23960 (55632)	55632..55838	+	207	WP_245146926.1	single-stranded DNA-binding protein	-
NFK54_RS23965 (55862)	55862..56158	+	297	WP_105282070.1	hypothetical protein	-
NFK54_RS23970 (56317)	56317..56559	+	243	WP_000540591.1	hypothetical protein	-
NFK54_RS23975 (56556)	56556..56675	+	120	Protein_67	class I SAM-dependent methyltransferase	-
NFK54_RS23980 (56764)	56764..57180	-	417	Protein_68	hypothetical protein	-
NFK54_RS23985 (57250)	57250..57456	+	207	WP_279283664.1	single-stranded DNA-binding protein	-
NFK54_RS23990 (57479)	57479..57775	+	297	WP_001272240.1	hypothetical protein	-
NFK54_RS23995 (57882)	57882..58703	+	822	WP_001234451.1	DUF932 domain-containing protein	-
NFK54_RS24000 (58982)	58982..59434	-	453	WP_024212709.1	transglycosylase SLT domain-containing protein	-

Associated MGEs

MGE detail	Similar MGEs	Relative position	MGE Type	Cargo ARG	Virulence gene	Coordinates	Length (bp)
	-	inside	Non-Mobilizable plasmid	-	pefD	1..98156	98156

Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.

Domains

Predicted by InterproScan

Toxin

• Hok/gef cell toxic protein (1-35)

Sequences

Toxin

Protein

• Length: 41 a.a.
• Molecular weight: 4506.32 Da
• Isoelectric Point: 8.2691

>T248563 WP_223163518.1 NZ_CP099345:54843-54965 [Escherichia marmotae]
IVCCTLLIFTLLTRNRLCEVRLKDGYREVTASLAYESGGK

Nucleotide

• Length: 123 bp

Antitoxin

Nucleotide

• Length: 198 bp

>AT248563 NZ_CP099345:54541-54738 [Escherichia marmotae]
TCACACGGATTGCCCGTGAACTGGCTGAACGACCAGATTATTTTCAGGGAAAGTGAGTGTGGTCAGCGTGCAGGTATATG
GGCTATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAAGGTGGTTTGTTATCCTGTCGTGTGGCAGAAAGC
AGAAAGCCCCGTAGTTAATTTTCATTAACCCACGAGGC

Structures

Antitoxin