Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 474662..474910 | Replicon | chromosome |
| Accession | NZ_CP098743 | ||
| Organism | Enterococcus faecalis strain M9 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | NDO76_RS02320 | Protein ID | WP_219843903.1 |
| Coordinates | 474662..474772 (+) | Length | 37 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 474755..474910 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NDO76_RS02310 (470094) | 470094..472352 | + | 2259 | WP_033627614.1 | DNA helicase PcrA | - |
| NDO76_RS02315 (472478) | 472478..474508 | + | 2031 | WP_002358699.1 | NAD-dependent DNA ligase LigA | - |
| NDO76_RS02320 (474662) | 474662..474772 | + | 111 | WP_219843903.1 | putative holin-like toxin | Toxin |
| - (474683) | 474683..474888 | - | 206 | NuclAT_6 | - | - |
| - (474755) | 474755..474890 | - | 136 | NuclAT_14 | - | - |
| - (474755) | 474755..474910 | - | 156 | NuclAT_8 | - | Antitoxin |
| NDO76_RS02325 (475090) | 475090..475395 | + | 306 | WP_002355569.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC | - |
| NDO76_RS02330 (475395) | 475395..476864 | + | 1470 | WP_016615972.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA | - |
| NDO76_RS02335 (476864) | 476864..478294 | + | 1431 | WP_016615973.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB | - |
| NDO76_RS02340 (478313) | 478313..479401 | + | 1089 | WP_002396964.1 | diacylglycerol kinase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 37 a.a. Molecular weight: 3805.59 Da Isoelectric Point: 5.9482
>T247972 WP_219843903.1 NZ_CP098743:474662-474772 [Enterococcus faecalis]
MSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
MSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
Download Length: 111 bp
Antitoxin
Download Length: 156 bp
>AT247972 NZ_CP098743:c474910-474755 [Enterococcus faecalis]
GAAATATGTTATTATGAAAATGAAAAGAGAGATATGCAGGAACATACCTCTCTAATAGCCACTACCAGTTATAAGAACTG
GTGGCTTACTGAGTTATTGGTTTTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTT
GAAATATGTTATTATGAAAATGAAAAGAGAGATATGCAGGAACATACCTCTCTAATAGCCACTACCAGTTATAAGAACTG
GTGGCTTACTGAGTTATTGGTTTTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTT
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|