Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2674988..2675213 | Replicon | chromosome |
| Accession | NZ_CP098418 | ||
| Organism | Enterococcus faecalis strain CQ025 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | NAG09_RS12975 | Protein ID | WP_075551663.1 |
| Coordinates | 2675112..2675213 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2674988..2675167 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NAG09_RS12945 (2670206) | 2670206..2671159 | - | 954 | WP_010709946.1 | siderophore ABC transporter substrate-binding protein | - |
| NAG09_RS12950 (2671198) | 2671198..2671953 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| NAG09_RS12955 (2671950) | 2671950..2672915 | - | 966 | WP_016622541.1 | iron chelate uptake ABC transporter family permease subunit | - |
| NAG09_RS12960 (2672912) | 2672912..2673859 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| NAG09_RS12965 (2674044) | 2674044..2674496 | + | 453 | WP_002359057.1 | YueI family protein | - |
| - (2674522) | 2674522..2674729 | + | 208 | NuclAT_3 | - | - |
| - (2674559) | 2674559..2674733 | + | 175 | NuclAT_6 | - | - |
| NAG09_RS12970 (2674678) | 2674678..2674779 | - | 102 | WP_021164441.1 | putative holin-like toxin | - |
| - (2674954) | 2674954..2675163 | + | 210 | NuclAT_4 | - | - |
| - (2674988) | 2674988..2675167 | + | 180 | NuclAT_5 | - | Antitoxin |
| NAG09_RS12975 (2675112) | 2675112..2675213 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
| NAG09_RS12980 (2675401) | 2675401..2677671 | - | 2271 | WP_002368430.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| NAG09_RS12985 (2677842) | 2677842..2678342 | + | 501 | WP_010709949.1 | cysteine hydrolase family protein | - |
| NAG09_RS12990 (2679043) | 2679043..2679939 | + | 897 | WP_002354953.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T247601 WP_075551663.1 NZ_CP098418:c2675213-2675112 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 180 bp
>AT247601 NZ_CP098418:2674988-2675167 [Enterococcus faecalis]
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAGTGCAACAA
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAGTGCAACAA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|