Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | hok-sok/- |
| Location | 29733..30151 | Replicon | plasmid pZ0117EC0005-2 |
| Accession | NZ_CP098225 | ||
| Organism | Escherichia coli strain Z0117EC0005 | ||
Toxin (Protein)
| Gene name | hok | Uniprot ID | - |
| Locus tag | NBY12_RS24000 | Protein ID | WP_223412041.1 |
| Coordinates | 30029..30151 (+) | Length | 41 a.a. |
Antitoxin (RNA)
| Gene name | srnC | ||
| Locus tag | - | ||
| Coordinates | 29733..29937 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NBY12_RS23965 | 25433..25954 | + | 522 | WP_012881138.1 | single-stranded DNA-binding protein | - |
| NBY12_RS23970 | 26010..26243 | + | 234 | WP_000005971.1 | DUF905 domain-containing protein | - |
| NBY12_RS23975 | 26307..28265 | + | 1959 | WP_233108850.1 | ParB/RepB/Spo0J family partition protein | - |
| NBY12_RS23980 | 28320..28754 | + | 435 | WP_021572430.1 | conjugation system SOS inhibitor PsiB | - |
| NBY12_RS23985 | 28751..29470 | + | 720 | WP_100774605.1 | plasmid SOS inhibition protein A | - |
| NBY12_RS23990 | 29467..29781 | + | 315 | WP_000872086.1 | hypothetical protein | - |
| - | 29730..29937 | + | 208 | NuclAT_0 | - | - |
| - | 29730..29937 | + | 208 | NuclAT_0 | - | - |
| - | 29730..29937 | + | 208 | NuclAT_0 | - | - |
| - | 29730..29937 | + | 208 | NuclAT_0 | - | - |
| - | 29733..29937 | - | 205 | - | - | Antitoxin |
| NBY12_RS23995 | 29971..30084 | + | 114 | Protein_42 | DUF5431 family protein | - |
| NBY12_RS24000 | 30029..30151 | + | 123 | WP_223412041.1 | Hok/Gef family protein | Toxin |
| NBY12_RS24005 | 30565..31068 | + | 504 | Protein_44 | IS66-like element accessory protein TnpA | - |
| NBY12_RS24010 | 31336..31659 | - | 324 | WP_025733244.1 | hypothetical protein | - |
| NBY12_RS24015 | 31620..32069 | - | 450 | WP_013362817.1 | hypothetical protein | - |
| NBY12_RS24020 | 32699..33436 | - | 738 | WP_250777852.1 | 23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B) | - |
| NBY12_RS24025 | 33562..33657 | - | 96 | WP_013362819.1 | 23S rRNA methyltransferase attenuation leader peptide | - |
| NBY12_RS24030 | 33792..34496 | + | 705 | WP_001067858.1 | IS6-like element IS26 family transposase | - |
| NBY12_RS24035 | 34549..34785 | - | 237 | Protein_50 | DUF3330 domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Non-Mobilizable plasmid | blaCTX-M-14 / erm(B) / aadA5 / qacE / sul1 / mph(A) / aac(3)-IId / blaTEM-1B | - | 1..57370 | 57370 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 41 a.a. Molecular weight: 4560.33 Da Isoelectric Point: 8.2774
>T247244 WP_223412041.1 NZ_CP098225:30029-30151 [Escherichia coli]
IVCCTLLIFTHLTRNRLCEVRLKDGYREVTASLAYESSGK
IVCCTLLIFTHLTRNRLCEVRLKDGYREVTASLAYESSGK
Download Length: 123 bp
Antitoxin
Download Length: 205 bp
>AT247244 NZ_CP098225:c29937-29733 [Escherichia coli]
AGACATACAGGGGGCCTCGTGGGTTAATGAAAAATTAACTACGGGGCTTTCTGCCTTCTGCCACACAACACGGTAACAAA
CCACCTTCACGTCATGAGGCAGAAAGCCTCAAGCGCCGGGCACATCATAGCCCATATACCTGCGCACTGACCACACTCAC
TTTCCCTGAAAATAATCCGGTCGTTCAGCCAGTTCACGGGCAATC
AGACATACAGGGGGCCTCGTGGGTTAATGAAAAATTAACTACGGGGCTTTCTGCCTTCTGCCACACAACACGGTAACAAA
CCACCTTCACGTCATGAGGCAGAAAGCCTCAAGCGCCGGGCACATCATAGCCCATATACCTGCGCACTGACCACACTCAC
TTTCCCTGAAAATAATCCGGTCGTTCAGCCAGTTCACGGGCAATC
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|