Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2732337..2732822 | Replicon | chromosome |
| Accession | NZ_CP098025 | ||
| Organism | Enterococcus faecalis strain QZ076 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | NAG05_RS13570 | Protein ID | WP_021164441.1 |
| Coordinates | 2732337..2732438 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2732613..2732822 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NAG05_RS13545 (2727865) | 2727865..2728818 | - | 954 | WP_010709946.1 | siderophore ABC transporter substrate-binding protein | - |
| NAG05_RS13550 (2728857) | 2728857..2729612 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| NAG05_RS13555 (2729609) | 2729609..2730574 | - | 966 | WP_016622541.1 | iron chelate uptake ABC transporter family permease subunit | - |
| NAG05_RS13560 (2730571) | 2730571..2731518 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| NAG05_RS13565 (2731703) | 2731703..2732155 | + | 453 | WP_002359057.1 | YueI family protein | - |
| - (2732181) | 2732181..2732388 | + | 208 | NuclAT_3 | - | - |
| - (2732218) | 2732218..2732392 | + | 175 | NuclAT_6 | - | - |
| NAG05_RS13570 (2732337) | 2732337..2732438 | - | 102 | WP_021164441.1 | putative holin-like toxin | Toxin |
| - (2732613) | 2732613..2732822 | + | 210 | NuclAT_4 | - | Antitoxin |
| - (2732647) | 2732647..2732826 | + | 180 | NuclAT_5 | - | - |
| NAG05_RS13575 (2732771) | 2732771..2732872 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
| NAG05_RS13580 (2733060) | 2733060..2735330 | - | 2271 | WP_002368430.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| NAG05_RS13585 (2735501) | 2735501..2736001 | + | 501 | WP_010709949.1 | cysteine hydrolase family protein | - |
| NAG05_RS13590 (2736702) | 2736702..2737598 | + | 897 | WP_002354953.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3598.36 Da Isoelectric Point: 6.0656
>T246550 WP_021164441.1 NZ_CP098025:c2732438-2732337 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNNKK
MSIEAALELMISFAAFVALLIFGILEATKNNKK
Download Length: 102 bp
Antitoxin
Download Length: 210 bp
>AT246550 NZ_CP098025:2732613-2732822 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|