Detailed information of TA system TA246145

Bioinformatically predicted

Overview

TA module

• Type: I
• Classification (family/domain): hok-sok/-
• Location: 71291..71716
• Replicon: plasmid pMS1679-1
• Accession: NZ_CP097720
• Organism: Escherichia coli strain MS1679

Toxin (Protein)

• Gene name: hok
• Uniprot ID: -
• Locus tag: M9O74_RS25710
• Protein ID: WP_227898123.1
• Coordinates: 71597..71716 (+)
• Length: 40 a.a.

Antitoxin (RNA)

Gene name	srnC
Locus tag	-
Coordinates	71291..71502 (+)

Genomic Context

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
M9O74_RS25680 (67265)	67265..67762	+	498	WP_050427786.1	single-stranded DNA-binding protein	-
M9O74_RS25685 (67825)	67825..68058	+	234	WP_001209608.1	DUF905 domain-containing protein	-
M9O74_RS25690 (68117)	68117..70075	+	1959	Protein_61	ParB/RepB/Spo0J family partition protein	-
M9O74_RS25695 (70130)	70130..70564	+	435	WP_000845935.1	conjugation system SOS inhibitor PsiB	-
M9O74_RS25700 (70561)	70561..71280	+	720	WP_001276275.1	plasmid SOS inhibition protein A	-
- (71291)	71291..71502	+	212	NuclAT_0	-	Antitoxin
- (71291)	71291..71502	+	212	NuclAT_0	-	Antitoxin
- (71291)	71291..71502	+	212	NuclAT_0	-	Antitoxin
- (71291)	71291..71502	+	212	NuclAT_0	-	Antitoxin
M9O74_RS25705 (71536)	71536..71649	+	114	Protein_64	DUF5431 family protein	-
M9O74_RS25710 (71597)	71597..71716	+	120	WP_227898123.1	Hok/Gef family protein	Toxin
M9O74_RS25715 (72017)	72017..72338	-	322	Protein_66	hypothetical protein	-
M9O74_RS25720 (72340)	72340..72626	+	287	Protein_67	hypothetical protein	-
M9O74_RS25725 (72745)	72745..73566	+	822	WP_001234485.1	DUF932 domain-containing protein	-
M9O74_RS25730 (73862)	73862..74464	-	603	WP_023145258.1	transglycosylase SLT domain-containing protein	-
M9O74_RS25735 (74786)	74786..75169	+	384	WP_000124981.1	conjugal transfer relaxosome DNA-binding protein TraM	-
M9O74_RS25740 (75359)	75359..76045	+	687	WP_072745528.1	PAS domain-containing protein	-
M9O74_RS25745 (76139)	76139..76366	+	228	WP_001442099.1	conjugal transfer relaxosome protein TraY	-

Associated MGEs

MGE detail	Similar MGEs	Relative position	MGE Type	Cargo ARG	Virulence gene	Coordinates	Length (bp)
	-	inside	Conjugative plasmid	sitABCD	iucA / iucB / iucC / iucD / iutA / vat / iroN / iroE / iroD / iroC / iroB	1..201944	201944
	-	flank	IS/Tn	-	-	65916..66419	503

Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.

Domains

Predicted by InterproScan

Toxin

• Hok/gef cell toxic protein (1-34)

Sequences

Toxin

Protein

• Length: 40 a.a.
• Molecular weight: 4423.19 Da
• Isoelectric Point: 8.2691

>T246145 WP_227898123.1 NZ_CP097720:71597-71716 [Escherichia coli]
VCCTLLIFTLLTRNRLCEVRLKDGYREVTASLAYESSGK

Nucleotide

• Length: 120 bp

Antitoxin

Nucleotide

• Length: 212 bp

>AT246145 NZ_CP097720:71291-71502 [Escherichia coli]
TCACACGGATTTCCCGTGAACGGTCTGAATGAGCGGATTCTTTTCAGGAAAAGTGAGTGTGGTCAGCGTGCAGGGATATG
AGCTATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAAGGTGGTTTGTTACCGTGTTGTGTGGCAGAAGGC
AGAAAGCCCCGTAGTTAATTTTTCATTAACCCACGAGGCCCCCTGTATGTCT

Structures

Antitoxin