Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | hok-sok/- |
| Location | 97303..97728 | Replicon | plasmid pMS1718-1 |
| Accession | NZ_CP097712 | ||
| Organism | Escherichia coli strain MS1737 | ||
Toxin (Protein)
| Gene name | hok | Uniprot ID | - |
| Locus tag | M9O76_RS23780 | Protein ID | WP_227898123.1 |
| Coordinates | 97303..97422 (-) | Length | 40 a.a. |
Antitoxin (RNA)
| Gene name | srnC | ||
| Locus tag | - | ||
| Coordinates | 97517..97728 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| M9O76_RS23745 (92651) | 92651..92878 | - | 228 | WP_001254385.1 | conjugal transfer relaxosome protein TraY | - |
| M9O76_RS23750 (92972) | 92972..93658 | - | 687 | WP_267326376.1 | PAS domain-containing protein | - |
| M9O76_RS23755 (93848) | 93848..94231 | - | 384 | WP_000124981.1 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| M9O76_RS23760 (94565) | 94565..95155 | + | 591 | WP_170316269.1 | transglycosylase SLT domain-containing protein | - |
| M9O76_RS23765 (95451) | 95451..96273 | - | 823 | Protein_116 | DUF932 domain-containing protein | - |
| M9O76_RS23770 (96392) | 96392..96679 | - | 288 | WP_000107535.1 | hypothetical protein | - |
| M9O76_RS23775 (96681) | 96681..97002 | + | 322 | Protein_118 | hypothetical protein | - |
| M9O76_RS23780 (97303) | 97303..97422 | - | 120 | WP_227898123.1 | Hok/Gef family protein | Toxin |
| M9O76_RS23785 (97370) | 97370..97483 | - | 114 | Protein_120 | DUF5431 family protein | - |
| - (97517) | 97517..97728 | - | 212 | NuclAT_0 | - | Antitoxin |
| - (97517) | 97517..97728 | - | 212 | NuclAT_0 | - | Antitoxin |
| - (97517) | 97517..97728 | - | 212 | NuclAT_0 | - | Antitoxin |
| - (97517) | 97517..97728 | - | 212 | NuclAT_0 | - | Antitoxin |
| M9O76_RS23790 (97739) | 97739..98458 | - | 720 | WP_001276275.1 | plasmid SOS inhibition protein A | - |
| M9O76_RS23795 (98455) | 98455..98889 | - | 435 | WP_000845935.1 | conjugation system SOS inhibitor PsiB | - |
| M9O76_RS23800 (98944) | 98944..100902 | - | 1959 | Protein_123 | ParB/RepB/Spo0J family partition protein | - |
| M9O76_RS23805 (100961) | 100961..101194 | - | 234 | WP_001209608.1 | DUF905 domain-containing protein | - |
| M9O76_RS23810 (101257) | 101257..101754 | - | 498 | WP_050427786.1 | single-stranded DNA-binding protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Conjugative plasmid | sitABCD | vat / iucA / iucB / iucC / iucD / iutA / iroB / iroC / iroD / iroE / iroN | 1..188685 | 188685 | |
| - | flank | IS/Tn | - | - | 102600..103103 | 503 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 40 a.a. Molecular weight: 4423.19 Da Isoelectric Point: 8.2691
>T246071 WP_227898123.1 NZ_CP097712:c97422-97303 [Escherichia coli]
VCCTLLIFTLLTRNRLCEVRLKDGYREVTASLAYESSGK
VCCTLLIFTLLTRNRLCEVRLKDGYREVTASLAYESSGK
Download Length: 120 bp
Antitoxin
Download Length: 212 bp
>AT246071 NZ_CP097712:c97728-97517 [Escherichia coli]
TCACACGGATTTCCCGTGAACGGTCTGAATGAGCGGATTCTTTTCAGGAAAAGTGAGTGTGGTCAGCGTGCAGGGATATG
AGCTATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAAGGTGGTTTGTTACCGTGTTGTGTGGCAGAAGGC
AGAAAGCCCCGTAGTTAATTTTTCATTAACCCACGAGGCCCCCTGTATGTCT
TCACACGGATTTCCCGTGAACGGTCTGAATGAGCGGATTCTTTTCAGGAAAAGTGAGTGTGGTCAGCGTGCAGGGATATG
AGCTATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAAGGTGGTTTGTTACCGTGTTGTGTGGCAGAAGGC
AGAAAGCCCCGTAGTTAATTTTTCATTAACCCACGAGGCCCCCTGTATGTCT
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
