Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2499887..2500111 | Replicon | chromosome |
Accession | NZ_CP097069 | ||
Organism | Enterococcus faecalis strain AT40a |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | M2912_RS12065 | Protein ID | WP_224561205.1 |
Coordinates | 2500010..2500111 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2499887..2500065 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
M2912_RS12040 | 2495534..2496487 | - | 954 | WP_002359060.1 | siderophore ABC transporter substrate-binding protein | - |
M2912_RS12045 | 2496526..2497281 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
M2912_RS12050 | 2497278..2498243 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
M2912_RS12055 | 2498240..2499187 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
M2912_RS12060 | 2499372..2499824 | + | 453 | WP_002378807.1 | YueI family protein | - |
- | 2499887..2500065 | + | 179 | - | - | Antitoxin |
M2912_RS12065 | 2500010..2500111 | - | 102 | WP_224561205.1 | putative holin-like toxin | Toxin |
M2912_RS12070 | 2500302..2502572 | - | 2271 | WP_078122760.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
M2912_RS12075 | 2502743..2503249 | + | 507 | WP_002378810.1 | cysteine hydrolase family protein | - |
M2912_RS12080 | 2503439..2504335 | + | 897 | WP_002365354.1 | YitT family protein | - |
M2912_RS12085 | 2504386..2504784 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3629.37 Da Isoelectric Point: 4.5869
>T244701 WP_224561205.1 NZ_CP097069:c2500111-2500010 [Enterococcus faecalis]
MSIEATLELMISFAAFVALLIFGILEATKNDKK
MSIEATLELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 179 bp
>AT244701 NZ_CP097069:2499887-2500065 [Enterococcus faecalis]
AAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTT
TTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCG
AAAATCAGTAGTGCAACAA
AAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTT
TTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCG
AAAATCAGTAGTGCAACAA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|