Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2496402..2496628 | Replicon | chromosome |
| Accession | NZ_CP097066 | ||
| Organism | Enterococcus faecalis strain AT49a | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | M2922_RS11880 | Protein ID | WP_224561205.1 |
| Coordinates | 2496527..2496628 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2496402..2496582 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| M2922_RS11850 (2491620) | 2491620..2492573 | - | 954 | WP_174114190.1 | siderophore ABC transporter substrate-binding protein | - |
| M2922_RS11855 (2492612) | 2492612..2493367 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| M2922_RS11860 (2493364) | 2493364..2494329 | - | 966 | WP_002354961.1 | iron chelate uptake ABC transporter family permease subunit | - |
| M2922_RS11865 (2494326) | 2494326..2495273 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| M2922_RS11870 (2495458) | 2495458..2495910 | + | 453 | WP_002354958.1 | YueI family protein | - |
| - (2495936) | 2495936..2496143 | + | 208 | NuclAT_4 | - | - |
| - (2495973) | 2495973..2496147 | + | 175 | NuclAT_7 | - | - |
| M2922_RS11875 (2496092) | 2496092..2496193 | - | 102 | WP_021164441.1 | putative holin-like toxin | - |
| - (2496368) | 2496368..2496578 | + | 211 | NuclAT_5 | - | - |
| - (2496402) | 2496402..2496582 | + | 181 | NuclAT_6 | - | Antitoxin |
| M2922_RS11880 (2496527) | 2496527..2496628 | - | 102 | WP_224561205.1 | putative holin-like toxin | Toxin |
| M2922_RS11885 (2496818) | 2496818..2499088 | - | 2271 | WP_002368430.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| M2922_RS11890 (2499259) | 2499259..2499765 | + | 507 | WP_174114188.1 | cysteine hydrolase family protein | - |
| M2922_RS11895 (2499955) | 2499955..2500851 | + | 897 | WP_002368434.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3629.37 Da Isoelectric Point: 4.5869
>T244675 WP_224561205.1 NZ_CP097066:c2496628-2496527 [Enterococcus faecalis]
MSIEATLELMISFAAFVALLIFGILEATKNDKK
MSIEATLELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 181 bp
>AT244675 NZ_CP097066:2496402-2496582 [Enterococcus faecalis]
TGAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAG
TTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATAC
CGAAAATCAGTAGTGCAACAA
TGAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAG
TTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATAC
CGAAAATCAGTAGTGCAACAA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|