Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2569328..2569585 | Replicon | chromosome |
| Accession | NZ_CP097056 | ||
| Organism | Enterococcus faecalis strain AT09 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | M2903_RS12390 | Protein ID | WP_021164441.1 |
| Coordinates | 2569484..2569585 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2569328..2569535 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| M2903_RS12365 (2565012) | 2565012..2565965 | - | 954 | WP_174114190.1 | siderophore ABC transporter substrate-binding protein | - |
| M2903_RS12370 (2566004) | 2566004..2566759 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| M2903_RS12375 (2566756) | 2566756..2567721 | - | 966 | WP_002354961.1 | iron chelate uptake ABC transporter family permease subunit | - |
| M2903_RS12380 (2567718) | 2567718..2568665 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| M2903_RS12385 (2568850) | 2568850..2569302 | + | 453 | WP_002354958.1 | YueI family protein | - |
| - (2569328) | 2569328..2569535 | + | 208 | NuclAT_4 | - | Antitoxin |
| - (2569365) | 2569365..2569539 | + | 175 | NuclAT_7 | - | - |
| M2903_RS12390 (2569484) | 2569484..2569585 | - | 102 | WP_021164441.1 | putative holin-like toxin | Toxin |
| - (2569760) | 2569760..2569970 | + | 211 | NuclAT_5 | - | - |
| - (2569794) | 2569794..2569974 | + | 181 | NuclAT_6 | - | - |
| M2903_RS12395 (2569919) | 2569919..2570020 | - | 102 | WP_224561205.1 | putative holin-like toxin | - |
| M2903_RS12400 (2570210) | 2570210..2572480 | - | 2271 | WP_002368430.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| M2903_RS12405 (2572651) | 2572651..2573157 | + | 507 | WP_174114188.1 | cysteine hydrolase family protein | - |
| M2903_RS12410 (2573347) | 2573347..2574243 | + | 897 | WP_002368434.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3598.36 Da Isoelectric Point: 6.0656
>T244607 WP_021164441.1 NZ_CP097056:c2569585-2569484 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNNKK
MSIEAALELMISFAAFVALLIFGILEATKNNKK
Download Length: 102 bp
Antitoxin
Download Length: 208 bp
>AT244607 NZ_CP097056:2569328-2569535 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATAAAGATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTAT
TTTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATAAAGATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTAT
TTTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|