Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2593744..2594005 | Replicon | chromosome |
| Accession | NZ_CP097048 | ||
| Organism | Enterococcus faecalis strain AT22 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | M2906_RS12510 | Protein ID | WP_021164442.1 |
| Coordinates | 2593904..2594005 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2593744..2593950 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| M2906_RS12485 (2589428) | 2589428..2590381 | - | 954 | WP_002408267.1 | siderophore ABC transporter substrate-binding protein | - |
| M2906_RS12490 (2590420) | 2590420..2591175 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| M2906_RS12495 (2591172) | 2591172..2592137 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| M2906_RS12500 (2592134) | 2592134..2593081 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| M2906_RS12505 (2593266) | 2593266..2593718 | + | 453 | WP_010710887.1 | YueI family protein | - |
| - (2593744) | 2593744..2593950 | + | 207 | NuclAT_4 | - | Antitoxin |
| - (2593781) | 2593781..2593967 | + | 187 | NuclAT_3 | - | - |
| M2906_RS12510 (2593904) | 2593904..2594005 | - | 102 | WP_021164442.1 | putative holin-like toxin | Toxin |
| M2906_RS12515 (2594196) | 2594196..2596466 | - | 2271 | WP_002368430.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| M2906_RS12520 (2596637) | 2596637..2597143 | + | 507 | WP_010710886.1 | cysteine hydrolase family protein | - |
| M2906_RS12525 (2597333) | 2597333..2598229 | + | 897 | WP_002365354.1 | YitT family protein | - |
| M2906_RS12530 (2598280) | 2598280..2598678 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3625.38 Da Isoelectric Point: 4.5869
>T244589 WP_021164442.1 NZ_CP097048:c2594005-2593904 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFGILEATKNDKK
MSIEATLELMISFATLVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 207 bp
>AT244589 NZ_CP097048:2593744-2593950 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATAAAGATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGG
TTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
TTCCATTTATAATAGAATTATGCTATTATAAAGATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGG
TTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|