Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 467247..467491 | Replicon | chromosome |
Accession | NZ_CP097048 | ||
Organism | Enterococcus faecalis strain AT22 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | M2906_RS02315 | Protein ID | WP_225582204.1 |
Coordinates | 467247..467375 (+) | Length | 43 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 467286..467491 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
M2906_RS02305 (462697) | 462697..464955 | + | 2259 | WP_010710797.1 | DNA helicase PcrA | - |
M2906_RS02310 (465081) | 465081..467111 | + | 2031 | WP_010710796.1 | NAD-dependent DNA ligase LigA | - |
M2906_RS02315 (467247) | 467247..467375 | + | 129 | WP_225582204.1 | putative holin-like toxin | Toxin |
- (467286) | 467286..467491 | - | 206 | NuclAT_2 | - | Antitoxin |
M2906_RS02320 (467693) | 467693..467998 | + | 306 | WP_002355569.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC | - |
M2906_RS02325 (467998) | 467998..469467 | + | 1470 | WP_002368026.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA | - |
M2906_RS02330 (469467) | 469467..470897 | + | 1431 | WP_002358703.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB | - |
M2906_RS02335 (470916) | 470916..472004 | + | 1089 | WP_002396964.1 | diacylglycerol kinase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 43 a.a. Molecular weight: 4453.43 Da Isoelectric Point: 8.9940
>T244587 WP_225582204.1 NZ_CP097048:467247-467375 [Enterococcus faecalis]
MKGAMFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
MKGAMFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
Download Length: 129 bp
Antitoxin
Download Length: 206 bp
>AT244587 NZ_CP097048:c467491-467286 [Enterococcus faecalis]
AAAAGAGAGATATGCAGGAACATACCTCTCTAGTAGCCACTACTAGTTATAAGAACTAGCGGCTTACTGAGTTATTGGTT
TTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTTGTTGTCTAAGACAAGCGCTAAGATAC
CGAAGATAATGGTCACAACAAGTGTTGCAAAACCAATCATCAGTCC
AAAAGAGAGATATGCAGGAACATACCTCTCTAGTAGCCACTACTAGTTATAAGAACTAGCGGCTTACTGAGTTATTGGTT
TTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTTGTTGTCTAAGACAAGCGCTAAGATAC
CGAAGATAATGGTCACAACAAGTGTTGCAAAACCAATCATCAGTCC
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|