Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2533665..2533891 | Replicon | chromosome |
Accession | NZ_CP097046 | ||
Organism | Enterococcus faecalis strain AT29 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | M2907_RS12175 | Protein ID | WP_224561205.1 |
Coordinates | 2533790..2533891 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2533665..2533845 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
M2907_RS12145 (2528883) | 2528883..2529836 | - | 954 | WP_174114190.1 | siderophore ABC transporter substrate-binding protein | - |
M2907_RS12150 (2529875) | 2529875..2530630 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
M2907_RS12155 (2530627) | 2530627..2531592 | - | 966 | WP_002354961.1 | iron chelate uptake ABC transporter family permease subunit | - |
M2907_RS12160 (2531589) | 2531589..2532536 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
M2907_RS12165 (2532721) | 2532721..2533173 | + | 453 | WP_002354958.1 | YueI family protein | - |
- (2533199) | 2533199..2533406 | + | 208 | NuclAT_4 | - | - |
- (2533236) | 2533236..2533410 | + | 175 | NuclAT_7 | - | - |
M2907_RS12170 (2533355) | 2533355..2533456 | - | 102 | WP_021164441.1 | putative holin-like toxin | - |
- (2533631) | 2533631..2533841 | + | 211 | NuclAT_5 | - | - |
- (2533665) | 2533665..2533845 | + | 181 | NuclAT_6 | - | Antitoxin |
M2907_RS12175 (2533790) | 2533790..2533891 | - | 102 | WP_224561205.1 | putative holin-like toxin | Toxin |
M2907_RS12180 (2534081) | 2534081..2536351 | - | 2271 | WP_002368430.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
M2907_RS12185 (2536522) | 2536522..2537028 | + | 507 | WP_174114188.1 | cysteine hydrolase family protein | - |
M2907_RS12190 (2537218) | 2537218..2538114 | + | 897 | WP_002368434.1 | YitT family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3629.37 Da Isoelectric Point: 4.5869
>T244567 WP_224561205.1 NZ_CP097046:c2533891-2533790 [Enterococcus faecalis]
MSIEATLELMISFAAFVALLIFGILEATKNDKK
MSIEATLELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 181 bp
>AT244567 NZ_CP097046:2533665-2533845 [Enterococcus faecalis]
TGAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAG
TTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATAC
CGAAAATCAGTAGTGCAACAA
TGAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAG
TTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATAC
CGAAAATCAGTAGTGCAACAA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|