Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2568273..2568529 | Replicon | chromosome |
Accession | NZ_CP097038 | ||
Organism | Enterococcus faecalis strain AT39 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | M2911_RS12235 | Protein ID | WP_224800345.1 |
Coordinates | 2568428..2568529 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2568273..2568479 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
M2911_RS12210 | 2563957..2564910 | - | 954 | WP_002370087.1 | siderophore ABC transporter substrate-binding protein | - |
M2911_RS12215 | 2564949..2565704 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
M2911_RS12220 | 2565701..2566666 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
M2911_RS12225 | 2566663..2567610 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
M2911_RS12230 | 2567795..2568247 | + | 453 | WP_002378959.1 | YueI family protein | - |
- | 2568273..2568479 | + | 207 | - | - | Antitoxin |
M2911_RS12235 | 2568428..2568529 | - | 102 | WP_224800345.1 | putative holin-like toxin | Toxin |
M2911_RS12240 | 2569432..2571702 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
M2911_RS12245 | 2571873..2572379 | + | 507 | WP_010710886.1 | cysteine hydrolase family protein | - |
M2911_RS12250 | 2572569..2573465 | + | 897 | WP_002368434.1 | YitT family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3594.37 Da Isoelectric Point: 6.0656
>T244528 WP_224800345.1 NZ_CP097038:c2568529-2568428 [Enterococcus faecalis]
MSIEAALELMISFATLVALLIFGILEATKNNKK
MSIEAALELMISFATLVALLIFGILEATKNNKK
Download Length: 102 bp
Antitoxin
Download Length: 207 bp
>AT244528 NZ_CP097038:2568273-2568479 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTATACCAACA
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTATT
TTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTATACCAACA
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTATT
TTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|