Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2515798..2516022 | Replicon | chromosome |
Accession | NZ_CP097034 | ||
Organism | Enterococcus faecalis strain AT40b |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | M2913_RS12265 | Protein ID | WP_224561205.1 |
Coordinates | 2515921..2516022 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2515798..2515976 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
M2913_RS12240 | 2511445..2512398 | - | 954 | WP_002359060.1 | siderophore ABC transporter substrate-binding protein | - |
M2913_RS12245 | 2512437..2513192 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
M2913_RS12250 | 2513189..2514154 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
M2913_RS12255 | 2514151..2515098 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
M2913_RS12260 | 2515283..2515735 | + | 453 | WP_002378807.1 | YueI family protein | - |
- | 2515798..2515976 | + | 179 | - | - | Antitoxin |
M2913_RS12265 | 2515921..2516022 | - | 102 | WP_224561205.1 | putative holin-like toxin | Toxin |
M2913_RS12270 | 2516213..2518483 | - | 2271 | WP_002378809.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
M2913_RS12275 | 2518654..2519160 | + | 507 | WP_002378810.1 | cysteine hydrolase family protein | - |
M2913_RS12280 | 2519350..2520246 | + | 897 | WP_002365354.1 | YitT family protein | - |
M2913_RS12285 | 2520297..2520695 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3629.37 Da Isoelectric Point: 4.5869
>T244516 WP_224561205.1 NZ_CP097034:c2516022-2515921 [Enterococcus faecalis]
MSIEATLELMISFAAFVALLIFGILEATKNDKK
MSIEATLELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 179 bp
>AT244516 NZ_CP097034:2515798-2515976 [Enterococcus faecalis]
AAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTT
TTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCG
AAAATCAGTAGTGCAACAA
AAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTT
TTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCG
AAAATCAGTAGTGCAACAA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|