Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2519236..2519495 | Replicon | chromosome |
| Accession | NZ_CP097031 | ||
| Organism | Enterococcus faecalis strain AT41 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | M2914_RS12130 | Protein ID | WP_021164442.1 |
| Coordinates | 2519394..2519495 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2519236..2519440 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| M2914_RS12100 (2514489) | 2514489..2515442 | - | 954 | WP_116495158.1 | siderophore ABC transporter substrate-binding protein | - |
| M2914_RS12105 (2515481) | 2515481..2516236 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| M2914_RS12110 (2516233) | 2516233..2517198 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| M2914_RS12115 (2517195) | 2517195..2518142 | - | 948 | WP_002394759.1 | iron chelate uptake ABC transporter family permease subunit | - |
| M2914_RS12120 (2518326) | 2518326..2518778 | + | 453 | WP_010707017.1 | YueI family protein | - |
| - (2518804) | 2518804..2519011 | + | 208 | NuclAT_11 | - | - |
| - (2518841) | 2518841..2519015 | + | 175 | NuclAT_20 | - | - |
| M2914_RS12125 (2518960) | 2518960..2519061 | - | 102 | WP_228088368.1 | putative holin-like toxin | - |
| - (2519236) | 2519236..2519440 | + | 205 | NuclAT_12 | - | Antitoxin |
| - (2519270) | 2519270..2519457 | + | 188 | NuclAT_19 | - | - |
| M2914_RS12130 (2519394) | 2519394..2519495 | - | 102 | WP_021164442.1 | putative holin-like toxin | Toxin |
| M2914_RS12135 (2519686) | 2519686..2521956 | - | 2271 | WP_116495157.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| M2914_RS12140 (2522127) | 2522127..2522627 | + | 501 | WP_002378961.1 | cysteine hydrolase family protein | - |
| M2914_RS12145 (2522973) | 2522973..2523869 | + | 897 | WP_002354953.1 | YitT family protein | - |
| M2914_RS12150 (2523920) | 2523920..2524318 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3625.38 Da Isoelectric Point: 4.5869
>T244488 WP_021164442.1 NZ_CP097031:c2519495-2519394 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFGILEATKNDKK
MSIEATLELMISFATLVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 205 bp
>AT244488 NZ_CP097031:2519236-2519440 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGTGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGTGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|