Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 462574..462806 | Replicon | chromosome |
Accession | NZ_CP097031 | ||
Organism | Enterococcus faecalis strain AT41 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | Q837V5 |
Locus tag | M2914_RS02270 | Protein ID | WP_002366178.1 |
Coordinates | 462574..462690 (+) | Length | 39 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 462601..462806 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
M2914_RS02260 (458012) | 458012..460270 | + | 2259 | WP_116495118.1 | DNA helicase PcrA | - |
M2914_RS02265 (460396) | 460396..462426 | + | 2031 | WP_116495119.1 | NAD-dependent DNA ligase LigA | - |
M2914_RS02270 (462574) | 462574..462690 | + | 117 | WP_002366178.1 | putative holin-like toxin | Toxin |
- (462601) | 462601..462806 | - | 206 | NuclAT_10 | - | Antitoxin |
M2914_RS02275 (463008) | 463008..463313 | + | 306 | WP_002355569.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC | - |
M2914_RS02280 (463313) | 463313..464782 | + | 1470 | WP_002361259.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA | - |
M2914_RS02285 (464782) | 464782..466212 | + | 1431 | WP_002358703.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB | - |
M2914_RS02290 (466231) | 466231..467319 | + | 1089 | WP_002355572.1 | diacylglycerol kinase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 39 a.a. Molecular weight: 4108.01 Da Isoelectric Point: 5.9482
>T244482 WP_002366178.1 NZ_CP097031:462574-462690 [Enterococcus faecalis]
MFLSVEAALGLMIGFATLVVTIIFVILALVLDNKNNRS
MFLSVEAALGLMIGFATLVVTIIFVILALVLDNKNNRS
Download Length: 117 bp
Antitoxin
Download Length: 206 bp
>AT244482 NZ_CP097031:c462806-462601 [Enterococcus faecalis]
AAAAGAGAGATATGCAGGAACATACCTCTCTAGTAGCCACTACTAGTTATAAGAACTAGCGGCTTACTGAGTTATTGGTT
TTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTTGTTGTCTAAGACAAGCGCTAAGATAA
CGAAGATAATGGTCACAACAAGTGTTGCAAAACCAATCATCAGTCC
AAAAGAGAGATATGCAGGAACATACCTCTCTAGTAGCCACTACTAGTTATAAGAACTAGCGGCTTACTGAGTTATTGGTT
TTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTTGTTGTCTAAGACAAGCGCTAAGATAA
CGAAGATAATGGTCACAACAAGTGTTGCAAAACCAATCATCAGTCC
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|