Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 760710..760935 | Replicon | chromosome |
Accession | NZ_CP097010 | ||
Organism | Enterococcus faecalis strain AT48 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | M2921_RS03555 | Protein ID | WP_075551663.1 |
Coordinates | 760834..760935 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 760710..760889 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
M2921_RS03525 | 755926..756879 | - | 954 | WP_002375576.1 | siderophore ABC transporter substrate-binding protein | - |
M2921_RS03530 | 756918..757673 | - | 756 | WP_248860219.1 | ATP-binding cassette domain-containing protein | - |
M2921_RS03535 | 757670..758635 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
M2921_RS03540 | 758632..759579 | - | 948 | WP_010716775.1 | iron chelate uptake ABC transporter family permease subunit | - |
M2921_RS03545 | 759764..760216 | + | 453 | WP_002354958.1 | YueI family protein | - |
M2921_RS03550 | 760401..760502 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
- | 760710..760889 | + | 180 | - | - | Antitoxin |
M2921_RS03555 | 760834..760935 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
M2921_RS03560 | 761125..763395 | - | 2271 | WP_002398160.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
M2921_RS03565 | 763566..764066 | + | 501 | WP_002365352.1 | cysteine hydrolase family protein | - |
M2921_RS03570 | 764369..765265 | + | 897 | WP_002354953.1 | YitT family protein | - |
M2921_RS03575 | 765316..765714 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T244397 WP_075551663.1 NZ_CP097010:c760935-760834 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 180 bp
>AT244397 NZ_CP097010:760710-760889 [Enterococcus faecalis]
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAGTGCAACAA
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAGTGCAACAA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|