Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2462705..2462925 | Replicon | chromosome |
Accession | NZ_CP097008 | ||
Organism | Enterococcus faecalis strain AT50 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | M2923_RS11610 | Protein ID | WP_021164441.1 |
Coordinates | 2462824..2462925 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2462705..2462879 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
M2923_RS11585 (2458352) | 2458352..2459305 | - | 954 | WP_010709946.1 | siderophore ABC transporter substrate-binding protein | - |
M2923_RS11590 (2459344) | 2459344..2460099 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
M2923_RS11595 (2460096) | 2460096..2461061 | - | 966 | WP_016622541.1 | iron chelate uptake ABC transporter family permease subunit | - |
M2923_RS11600 (2461058) | 2461058..2462005 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
M2923_RS11605 (2462190) | 2462190..2462642 | + | 453 | WP_002359057.1 | YueI family protein | - |
- (2462668) | 2462668..2462875 | + | 208 | NuclAT_3 | - | - |
- (2462705) | 2462705..2462879 | + | 175 | NuclAT_6 | - | Antitoxin |
M2923_RS11610 (2462824) | 2462824..2462925 | - | 102 | WP_021164441.1 | putative holin-like toxin | Toxin |
- (2463100) | 2463100..2463309 | + | 210 | NuclAT_4 | - | - |
- (2463134) | 2463134..2463313 | + | 180 | NuclAT_5 | - | - |
M2923_RS11615 (2463258) | 2463258..2463359 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
M2923_RS11620 (2463547) | 2463547..2465817 | - | 2271 | WP_002368430.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
M2923_RS11625 (2465988) | 2465988..2466488 | + | 501 | WP_010709949.1 | cysteine hydrolase family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3598.36 Da Isoelectric Point: 6.0656
>T244383 WP_021164441.1 NZ_CP097008:c2462925-2462824 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNNKK
MSIEAALELMISFAAFVALLIFGILEATKNNKK
Download Length: 102 bp
Antitoxin
Download Length: 175 bp
>AT244383 NZ_CP097008:2462705-2462879 [Enterococcus faecalis]
AAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTT
TTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTATTTTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAA
TCAGTAGTGCAACAA
AAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTT
TTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTATTTTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAA
TCAGTAGTGCAACAA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|