Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2464747..2464971 | Replicon | chromosome |
| Accession | NZ_CP097006 | ||
| Organism | Enterococcus faecalis strain LS05-1 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | M2924_RS11555 | Protein ID | WP_162780856.1 |
| Coordinates | 2464870..2464971 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2464747..2464933 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| M2924_RS11530 (2460365) | 2460365..2461318 | - | 954 | WP_002375576.1 | siderophore ABC transporter substrate-binding protein | - |
| M2924_RS11535 (2461357) | 2461357..2462112 | - | 756 | WP_002375575.1 | ATP-binding cassette domain-containing protein | - |
| M2924_RS11540 (2462109) | 2462109..2463074 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| M2924_RS11545 (2463071) | 2463071..2464018 | - | 948 | WP_002375573.1 | iron chelate uptake ABC transporter family permease subunit | - |
| M2924_RS11550 (2464202) | 2464202..2464654 | + | 453 | WP_002375572.1 | YueI family protein | - |
| - (2464710) | 2464710..2464916 | + | 207 | NuclAT_7 | - | - |
| - (2464747) | 2464747..2464933 | + | 187 | NuclAT_9 | - | Antitoxin |
| M2924_RS11555 (2464870) | 2464870..2464971 | - | 102 | WP_162780856.1 | putative holin-like toxin | Toxin |
| M2924_RS11560 (2465163) | 2465163..2467433 | - | 2271 | WP_002368430.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| M2924_RS11565 (2467604) | 2467604..2468104 | + | 501 | WP_002395960.1 | cysteine hydrolase family protein | - |
| M2924_RS11570 (2468903) | 2468903..2469799 | + | 897 | WP_002368434.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3624.40 Da Isoelectric Point: 6.0656
>T244365 WP_162780856.1 NZ_CP097006:c2464971-2464870 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFGILEATKNNKK
MSIEATLELMISFATLVALLIFGILEATKNNKK
Download Length: 102 bp
Antitoxin
Download Length: 187 bp
>AT244365 NZ_CP097006:2464747-2464933 [Enterococcus faecalis]
AAAAGAGAGGTATGCGGGTACATACCTCTCCTTTATACCAGCGCCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTT
TTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGTTATTTTTTATTGTTTTTCGTTGCTTCAAGGATACCG
AAAATCAGTAACGCAACAAGGGTTGCA
AAAAGAGAGGTATGCGGGTACATACCTCTCCTTTATACCAGCGCCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTT
TTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGTTATTTTTTATTGTTTTTCGTTGCTTCAAGGATACCG
AAAATCAGTAACGCAACAAGGGTTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|