Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2423822..2424302 | Replicon | chromosome |
| Accession | NZ_CP097002 | ||
| Organism | Enterococcus faecalis strain LS06-1 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | M2926_RS11420 | Protein ID | WP_224800345.1 |
| Coordinates | 2423822..2423923 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2424097..2424302 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| M2926_RS11395 | 2419351..2420304 | - | 954 | WP_002370087.1 | siderophore ABC transporter substrate-binding protein | - |
| M2926_RS11400 | 2420343..2421098 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| M2926_RS11405 | 2421095..2422060 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| M2926_RS11410 | 2422057..2423004 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| M2926_RS11415 | 2423189..2423641 | + | 453 | WP_002378959.1 | YueI family protein | - |
| M2926_RS11420 | 2423822..2423923 | - | 102 | WP_224800345.1 | putative holin-like toxin | Toxin |
| - | 2424097..2424302 | + | 206 | - | - | Antitoxin |
| M2926_RS11425 | 2424826..2427096 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| M2926_RS11430 | 2427267..2427773 | + | 507 | WP_010710886.1 | cysteine hydrolase family protein | - |
| M2926_RS11435 | 2427963..2428859 | + | 897 | WP_002368434.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3594.37 Da Isoelectric Point: 6.0656
>T244347 WP_224800345.1 NZ_CP097002:c2423923-2423822 [Enterococcus faecalis]
MSIEAALELMISFATLVALLIFGILEATKNNKK
MSIEAALELMISFATLVALLIFGILEATKNNKK
Download Length: 102 bp
Antitoxin
Download Length: 206 bp
>AT244347 NZ_CP097002:2424097-2424302 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTATTT
TTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTATTT
TTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|