Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 367685..367911 | Replicon | chromosome |
Accession | NZ_CP092825 | ||
Organism | Staphylococcus aureus strain GY8 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | A0A0E0VS87 |
Locus tag | MK796_RS01740 | Protein ID | WP_000253688.1 |
Coordinates | 367685..367792 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF3 | ||
Locus tag | - | ||
Coordinates | 367845..367911 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
MK796_RS01720 (362946) | 362946..366626 | + | 3681 | WP_000582140.1 | phage tail spike protein | - |
MK796_RS01725 (366613) | 366613..366765 | + | 153 | WP_001181555.1 | hypothetical protein | - |
MK796_RS01730 (366812) | 366812..367099 | + | 288 | WP_001040257.1 | hypothetical protein | - |
MK796_RS01735 (367157) | 367157..367453 | + | 297 | WP_000539688.1 | DUF2951 domain-containing protein | - |
MK796_RS01740 (367685) | 367685..367792 | + | 108 | WP_000253688.1 | putative holin-like toxin | Toxin |
- (367845) | 367845..367911 | - | 67 | NuclAT_0 | - | Antitoxin |
- (367845) | 367845..367911 | - | 67 | NuclAT_0 | - | Antitoxin |
- (367845) | 367845..367911 | - | 67 | NuclAT_0 | - | Antitoxin |
- (367845) | 367845..367911 | - | 67 | NuclAT_0 | - | Antitoxin |
MK796_RS01745 (367836) | 367836..367940 | - | 105 | Protein_347 | hypothetical protein | - |
MK796_RS01750 (367991) | 367991..368293 | + | 303 | WP_000387656.1 | phage holin | - |
MK796_RS01755 (368305) | 368305..369759 | + | 1455 | WP_103067904.1 | N-acetylmuramoyl-L-alanine amidase | - |
MK796_RS01760 (370004) | 370004..370156 | + | 153 | WP_001788502.1 | hypothetical protein | - |
MK796_RS01765 (370227) | 370227..370337 | + | 111 | WP_000139423.1 | hypothetical protein | - |
MK796_RS01770 (370339) | 370339..370524 | + | 186 | WP_001286805.1 | hypothetical protein | - |
MK796_RS01775 (370871) | 370871..371920 | + | 1050 | WP_000405105.1 | hypothetical protein | - |
MK796_RS01780 (372018) | 372018..372200 | + | 183 | WP_000990948.1 | hypothetical protein | - |
MK796_RS01785 (372197) | 372197..372880 | + | 684 | WP_000180531.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 329549..370524 | 40975 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3817.78 Da Isoelectric Point: 10.4997
>T237200 WP_000253688.1 NZ_CP092825:367685-367792 [Staphylococcus aureus]
VVSIVDALNLMFSFGMFIVTLLGLVIAIVKLSHKK
VVSIVDALNLMFSFGMFIVTLLGLVIAIVKLSHKK
Download Length: 108 bp
>T237200 NZ_LR792628:c3181121-3181019 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 67 bp
>AT237200 NZ_CP092825:c367911-367845 [Staphylococcus aureus]
ATAAATAGAAAAAGGGCAACATGCGGAAACATGTTACCCTAGTGAGCCCGTTAAAAAGACGGTGGCT
ATAAATAGAAAAAGGGCAACATGCGGAAACATGTTACCCTAGTGAGCCCGTTAAAAAGACGGTGGCT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|