Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2519671..2519931 | Replicon | chromosome |
| Accession | NZ_CP086566 | ||
| Organism | Enterococcus faecalis strain E512-TC2 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | LM512_RS11990 | Protein ID | WP_075551663.1 |
| Coordinates | 2519830..2519931 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2519671..2519881 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LM512_RS11965 | 2515355..2516308 | - | 954 | WP_002354964.1 | siderophore ABC transporter substrate-binding protein | - |
| LM512_RS11965 | 2515355..2516308 | - | 954 | WP_002354964.1 | siderophore ABC transporter substrate-binding protein | - |
| LM512_RS11970 | 2516347..2517102 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| LM512_RS11970 | 2516347..2517102 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| LM512_RS11975 | 2517099..2518064 | - | 966 | WP_002354961.1 | iron chelate uptake ABC transporter family permease subunit | - |
| LM512_RS11975 | 2517099..2518064 | - | 966 | WP_002354961.1 | iron chelate uptake ABC transporter family permease subunit | - |
| LM512_RS11980 | 2518061..2519008 | - | 948 | WP_002394759.1 | iron chelate uptake ABC transporter family permease subunit | - |
| LM512_RS11980 | 2518061..2519008 | - | 948 | WP_002394759.1 | iron chelate uptake ABC transporter family permease subunit | - |
| LM512_RS11985 | 2519193..2519645 | + | 453 | WP_002354958.1 | YueI family protein | - |
| LM512_RS11985 | 2519193..2519645 | + | 453 | WP_002354958.1 | YueI family protein | - |
| - | 2519671..2519881 | + | 211 | - | - | Antitoxin |
| - | 2519708..2519885 | + | 178 | - | - | - |
| LM512_RS11990 | 2519830..2519931 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
| LM512_RS11990 | 2519830..2519931 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
| LM512_RS11995 | 2520263..2520364 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
| LM512_RS11995 | 2520263..2520364 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
| LM512_RS12000 | 2520554..2522824 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| LM512_RS12000 | 2520554..2522824 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| LM512_RS12005 | 2522995..2523495 | + | 501 | WP_002354954.1 | cysteine hydrolase family protein | - |
| LM512_RS12005 | 2522995..2523495 | + | 501 | WP_002354954.1 | cysteine hydrolase family protein | - |
| LM512_RS12010 | 2523798..2524694 | + | 897 | WP_002365354.1 | YitT family protein | - |
| LM512_RS12010 | 2523798..2524694 | + | 897 | WP_002365354.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T223897 WP_075551663.1 NZ_CP086566:c2519931-2519830 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
>T223897 NZ_CP119400:2640202-2640309 [Escherichia coli]
ATGACGCTCGCGCAGTTTGCCATGACTTTCTGGCACGACCTGGCGGCACCGATCCTGGCGGGAATTATTACCGCAGCGAT
TGTCGGCTGGTGGCGTAACCGGAAGTAA
ATGACGCTCGCGCAGTTTGCCATGACTTTCTGGCACGACCTGGCGGCACCGATCCTGGCGGGAATTATTACCGCAGCGAT
TGTCGGCTGGTGGCGTAACCGGAAGTAA
Antitoxin
Download Length: 211 bp
>AT223897 NZ_CP086566:2519671-2519881 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|