Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | SprG2-SprA2AS/- |
Location | 973064..973281 | Replicon | chromosome |
Accession | NC_007622 | ||
Organism | Staphylococcus aureus RF122 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | SAB_RS04795 | Protein ID | WP_000623369.1 |
Coordinates | 973064..973171 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprA2AS | ||
Locus tag | - | ||
Coordinates | 973166..973281 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
SAB_RS04770 | 969737..970306 | - | 570 | WP_000283455.1 | competence protein ComK | - |
SAB_RS04775 | 970516..970734 | + | 219 | WP_000876826.1 | IDEAL domain-containing protein | - |
SAB_RS04780 | 970815..971801 | - | 987 | WP_000668820.1 | lipoate--protein ligase | - |
SAB_RS04785 | 972000..972176 | + | 177 | WP_000214898.1 | YkvS family protein | - |
SAB_RS04790 | 972191..972793 | + | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
SAB_RS04795 | 973064..973171 | + | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
- | 973166..973281 | - | 116 | - | - | Antitoxin |
SAB_RS04800 | 973710..973811 | + | 102 | WP_042852647.1 | hypothetical protein | - |
SAB_RS14385 | 973821..974093 | + | 273 | WP_078062708.1 | lactococcin 972 family bacteriocin | - |
SAB_RS04805 | 974136..976100 | + | 1965 | WP_000870792.1 | bacteriocin-associated integral membrane family protein | - |
SAB_RS04810 | 976103..976426 | + | 324 | WP_000668625.1 | YxeA family protein | - |
SAB_RS04815 | 976423..977061 | + | 639 | WP_042852651.1 | ABC transporter ATP-binding protein | - |
SAB_RS14390 | 977149..977439 | - | 291 | WP_001795266.1 | hypothetical protein | - |
SAB_RS04825 | 977772..978059 | + | 288 | WP_000410749.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T21360 WP_000623369.1 NC_007622:973064-973171 [Staphylococcus aureus RF122]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
>T21360 NC_007622:973064-973171 [Staphylococcus aureus RF122]
GTGATATCTATTGCAAATGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
GTGATATCTATTGCAAATGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
Antitoxin
Download Length: 116 bp
>AT21360 NC_007622:c973281-973166 [Staphylococcus aureus RF122]
GTAAAAAGACGACATGCAGGAACATGTCGCCAAATGAGCCCGTTAAAAAGACGGTGACTAAATGAGATTTTCTTTAACCA
TCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
GTAAAAAGACGACATGCAGGAACATGTCGCCAAATGAGCCCGTTAAAAAGACGGTGACTAAATGAGATTTTCTTTAACCA
TCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|