Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 693594..693820 | Replicon | chromosome |
Accession | NZ_CP077924 | ||
Organism | Staphylococcus aureus strain 200 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | A0A0E0VS87 |
Locus tag | KU536_RS03640 | Protein ID | WP_000253688.1 |
Coordinates | 693594..693701 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF3 | ||
Locus tag | - | ||
Coordinates | 693754..693820 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KU536_RS03620 (688855) | 688855..692535 | + | 3681 | WP_000582140.1 | phage tail spike protein | - |
KU536_RS03625 (692522) | 692522..692674 | + | 153 | WP_001181555.1 | hypothetical protein | - |
KU536_RS03630 (692721) | 692721..693008 | + | 288 | WP_001040257.1 | hypothetical protein | - |
KU536_RS03635 (693066) | 693066..693362 | + | 297 | WP_000539688.1 | DUF2951 domain-containing protein | - |
KU536_RS03640 (693594) | 693594..693701 | + | 108 | WP_000253688.1 | putative holin-like toxin | Toxin |
- (693754) | 693754..693820 | - | 67 | NuclAT_0 | - | Antitoxin |
- (693754) | 693754..693820 | - | 67 | NuclAT_0 | - | Antitoxin |
- (693754) | 693754..693820 | - | 67 | NuclAT_0 | - | Antitoxin |
- (693754) | 693754..693820 | - | 67 | NuclAT_0 | - | Antitoxin |
KU536_RS03645 (693745) | 693745..693849 | - | 105 | Protein_714 | hypothetical protein | - |
KU536_RS03650 (693900) | 693900..694202 | + | 303 | WP_000387656.1 | phage holin | - |
KU536_RS03655 (694214) | 694214..695668 | + | 1455 | WP_000930259.1 | N-acetylmuramoyl-L-alanine amidase | - |
KU536_RS03660 (695763) | 695763..696212 | - | 450 | WP_000727649.1 | chemotaxis-inhibiting protein CHIPS | - |
KU536_RS03665 (696897) | 696897..697247 | + | 351 | WP_000702263.1 | complement inhibitor SCIN-A | - |
KU536_RS03670 (697300) | 697300..697560 | - | 261 | WP_001791826.1 | hypothetical protein | - |
KU536_RS03675 (697871) | 697871..698050 | - | 180 | WP_000669789.1 | hypothetical protein | - |
KU536_RS03680 (698422) | 698422..698619 | - | 198 | WP_000239614.1 | phospholipase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | groEL / hlb / chp / scn | 646277..697247 | 50970 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3817.78 Da Isoelectric Point: 10.4997
>T208636 WP_000253688.1 NZ_CP077924:693594-693701 [Staphylococcus aureus]
VVSIVDALNLMFSFGMFIVTLLGLVIAIVKLSHKK
VVSIVDALNLMFSFGMFIVTLLGLVIAIVKLSHKK
Download Length: 108 bp
>T208636 NZ_CP103694:c4182801-4182628 [Escherichia coli]
ATGGCACTATTCTCTAAAATATTAATTTTTTATGTGATTGGTGTGAACATATCCTTTGTCATTATCTGGTTTATCTCACA
TGAGAAAACACATATTCGTTTACTTAGTGCATTCCTGGTCGGAATAACCTGGCCAATGAGTCTGCCTGTGGCATTACTTT
TTTCTCTCTTTTAG
ATGGCACTATTCTCTAAAATATTAATTTTTTATGTGATTGGTGTGAACATATCCTTTGTCATTATCTGGTTTATCTCACA
TGAGAAAACACATATTCGTTTACTTAGTGCATTCCTGGTCGGAATAACCTGGCCAATGAGTCTGCCTGTGGCATTACTTT
TTTCTCTCTTTTAG
Antitoxin
Download Length: 67 bp
>AT208636 NZ_CP077924:c693820-693754 [Staphylococcus aureus]
ATAAATAGAAAAAGGGCAACATGCGGAAACATGTTACCCTAGTGAGCCCGTTAAAAAGACGGTGGCT
ATAAATAGAAAAAGGGCAACATGCGGAAACATGTTACCCTAGTGAGCCCGTTAAAAAGACGGTGGCT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|