Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 1046788..1047037 | Replicon | chromosome |
Accession | NC_002952 | ||
Organism | Staphylococcus aureus subsp. aureus MRSA252 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | SAR_RS05085 | Protein ID | WP_000623369.1 |
Coordinates | 1046788..1046895 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF2 | ||
Locus tag | - | ||
Coordinates | 1046890..1047037 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
SAR_RS05060 | 1043461..1044030 | - | 570 | WP_000287265.1 | competence protein ComK | - |
SAR_RS05065 | 1044240..1044458 | + | 219 | WP_000876825.1 | IDEAL domain-containing protein | - |
SAR_RS05070 | 1044539..1045525 | - | 987 | WP_000668820.1 | lipoate--protein ligase | - |
SAR_RS05075 | 1045724..1045900 | + | 177 | WP_000214898.1 | YkvS family protein | - |
SAR_RS05080 | 1045915..1046517 | + | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
SAR_RS05085 | 1046788..1046895 | + | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
- | 1046890..1047037 | - | 148 | - | - | Antitoxin |
SAR_RS05090 | 1047434..1047535 | + | 102 | WP_001790623.1 | hypothetical protein | - |
SAR_RS15040 | 1047545..1047817 | + | 273 | WP_001794574.1 | lactococcin 972 family bacteriocin | - |
SAR_RS05095 | 1047861..1049825 | + | 1965 | WP_000870819.1 | bacteriocin-associated integral membrane family protein | - |
SAR_RS05100 | 1049828..1050148 | + | 321 | WP_000873929.1 | YxeA family protein | - |
SAR_RS05105 | 1050145..1050786 | + | 642 | WP_000571191.1 | ABC transporter ATP-binding protein | - |
SAR_RS15045 | 1050874..1051164 | - | 291 | WP_001791476.1 | hypothetical protein | - |
SAR_RS05115 | 1051505..1051792 | + | 288 | WP_000410718.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T20588 WP_000623369.1 NC_002952:1046788-1046895 [Staphylococcus aureus subsp. aureus MRSA252]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
>T20588 NC_002952:1046788-1046895 [Staphylococcus aureus subsp. aureus MRSA252]
GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
Antitoxin
Download Length: 148 bp
>AT20588 NC_002952:c1047037-1046890 [Staphylococcus aureus subsp. aureus MRSA252]
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|