Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 1074625..1074822 | Replicon | chromosome |
Accession | NZ_CP047839 | ||
Organism | Staphylococcus aureus strain UP_678 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | E3S85_RS05395 | Protein ID | WP_000623369.1 |
Coordinates | 1074715..1074822 (-) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF3 | ||
Locus tag | - | ||
Coordinates | 1074625..1074662 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
E3S85_RS05360 | 1069818..1070105 | - | 288 | WP_000410718.1 | hypothetical protein | - |
E3S85_RS05365 | 1070446..1070736 | + | 291 | WP_001791476.1 | hypothetical protein | - |
E3S85_RS05370 | 1070824..1071465 | - | 642 | WP_000571183.1 | ABC transporter ATP-binding protein | - |
E3S85_RS05375 | 1071462..1071782 | - | 321 | WP_000873929.1 | YxeA family protein | - |
E3S85_RS05380 | 1071785..1073749 | - | 1965 | WP_000870819.1 | bacteriocin-associated integral membrane family protein | - |
E3S85_RS05385 | 1073793..1074065 | - | 273 | WP_001794574.1 | lactococcin 972 family bacteriocin | - |
E3S85_RS05390 | 1074075..1074176 | - | 102 | WP_001790623.1 | hypothetical protein | - |
- | 1074625..1074662 | + | 38 | - | - | Antitoxin |
E3S85_RS05395 | 1074715..1074822 | - | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
E3S85_RS05400 | 1075093..1075695 | - | 603 | WP_160176022.1 | CPBP family intramembrane metalloprotease | - |
E3S85_RS05405 | 1075710..1075886 | - | 177 | WP_000214898.1 | YkvS family protein | - |
E3S85_RS05410 | 1076085..1077071 | + | 987 | WP_000668820.1 | lipoate--protein ligase | - |
E3S85_RS05415 | 1077152..1077370 | - | 219 | WP_000876825.1 | IDEAL domain-containing protein | - |
E3S85_RS05420 | 1077580..1078149 | + | 570 | WP_031775450.1 | competence protein ComK | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T148210 WP_000623369.1 NZ_CP047839:c1074822-1074715 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
>T148210 NZ_CP063476:844343-844446 [Escherichia coli]
GGCAAGGCAACTAAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTGTTCGGTCTCTTTTT
GGCAAGGCAACTAAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTGTTCGGTCTCTTTTT
Antitoxin
Download Length: 38 bp
>AT148210 NZ_CP047839:1074625-1074662 [Staphylococcus aureus]
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|