Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 1093166..1093363 | Replicon | chromosome |
Accession | NZ_CP047778 | ||
Organism | Staphylococcus aureus strain UP_1572 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | E3T13_RS05485 | Protein ID | WP_000623369.1 |
Coordinates | 1093256..1093363 (-) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF3 | ||
Locus tag | - | ||
Coordinates | 1093166..1093203 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
E3T13_RS05450 | 1088359..1088646 | - | 288 | WP_000410718.1 | hypothetical protein | - |
E3T13_RS05455 | 1088987..1089277 | + | 291 | WP_001791476.1 | hypothetical protein | - |
E3T13_RS05460 | 1089365..1090006 | - | 642 | WP_000571191.1 | ABC transporter ATP-binding protein | - |
E3T13_RS05465 | 1090003..1090323 | - | 321 | WP_000873929.1 | YxeA family protein | - |
E3T13_RS05470 | 1090326..1092290 | - | 1965 | WP_000870819.1 | bacteriocin-associated integral membrane family protein | - |
E3T13_RS05475 | 1092334..1092606 | - | 273 | WP_001794574.1 | lactococcin 972 family bacteriocin | - |
E3T13_RS05480 | 1092616..1092717 | - | 102 | WP_001790623.1 | hypothetical protein | - |
- | 1093166..1093203 | + | 38 | - | - | Antitoxin |
E3T13_RS05485 | 1093256..1093363 | - | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
E3T13_RS05490 | 1093634..1094236 | - | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
E3T13_RS05495 | 1094251..1094427 | - | 177 | WP_000214898.1 | YkvS family protein | - |
E3T13_RS05500 | 1094626..1095612 | + | 987 | WP_000668820.1 | lipoate--protein ligase | - |
E3T13_RS05505 | 1095693..1095911 | - | 219 | WP_000876825.1 | IDEAL domain-containing protein | - |
E3T13_RS05510 | 1096121..1096690 | + | 570 | WP_000287265.1 | competence protein ComK | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T147545 WP_000623369.1 NZ_CP047778:c1093363-1093256 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
>T147545 NZ_CP063046:2491760-2491867 [Escherichia coli]
ATGACGCTCGCAGAGCTGGGCATGGCCTTCTGGCATGATTTAGCGGCTCCGGTCATTGCTGGCATTCTTGCCAGTATGAT
CGTGAGCTGGCTGAACAAGCGGAAGTAA
ATGACGCTCGCAGAGCTGGGCATGGCCTTCTGGCATGATTTAGCGGCTCCGGTCATTGCTGGCATTCTTGCCAGTATGAT
CGTGAGCTGGCTGAACAAGCGGAAGTAA
Antitoxin
Download Length: 38 bp
>AT147545 NZ_CP047778:1093166-1093203 [Staphylococcus aureus]
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|