Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2962084..2962368 | Replicon | chromosome |
| Accession | NZ_CP039548 | ||
| Organism | Enterococcus faecalis strain VE18379 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | FAJ42_RS15725 | Protein ID | WP_002386265.1 |
| Coordinates | 2962240..2962368 (-) | Length | 43 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2962084..2962291 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| FAJ42_RS15700 | 2957768..2958721 | - | 954 | WP_002370087.1 | siderophore ABC transporter substrate-binding protein | - |
| FAJ42_RS15700 | 2957768..2958721 | - | 954 | WP_002370087.1 | siderophore ABC transporter substrate-binding protein | - |
| FAJ42_RS15705 | 2958760..2959515 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| FAJ42_RS15705 | 2958760..2959515 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| FAJ42_RS15710 | 2959512..2960477 | - | 966 | WP_002387376.1 | iron chelate uptake ABC transporter family permease subunit | - |
| FAJ42_RS15710 | 2959512..2960477 | - | 966 | WP_002387376.1 | iron chelate uptake ABC transporter family permease subunit | - |
| FAJ42_RS15715 | 2960474..2961421 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| FAJ42_RS15715 | 2960474..2961421 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| FAJ42_RS15720 | 2961606..2962058 | + | 453 | WP_002378959.1 | YueI family protein | - |
| FAJ42_RS15720 | 2961606..2962058 | + | 453 | WP_002378959.1 | YueI family protein | - |
| - | 2962084..2962291 | + | 208 | - | - | Antitoxin |
| FAJ42_RS15725 | 2962240..2962368 | - | 129 | WP_002386265.1 | hypothetical protein | Toxin |
| FAJ42_RS15725 | 2962240..2962368 | - | 129 | WP_002386265.1 | hypothetical protein | Toxin |
| FAJ42_RS15730 | 2962674..2962803 | - | 130 | Protein_2869 | putative holin-like toxin | - |
| FAJ42_RS15730 | 2962674..2962803 | - | 130 | Protein_2869 | putative holin-like toxin | - |
| FAJ42_RS15735 | 2962966..2965236 | - | 2271 | WP_002399785.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| FAJ42_RS15735 | 2962966..2965236 | - | 2271 | WP_002399785.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| FAJ42_RS15740 | 2965407..2965907 | + | 501 | WP_002378961.1 | cysteine hydrolase | - |
| FAJ42_RS15740 | 2965407..2965907 | + | 501 | WP_002378961.1 | cysteine hydrolase | - |
| FAJ42_RS15745 | 2966468..2967364 | + | 897 | WP_002354953.1 | YitT family protein | - |
| FAJ42_RS15745 | 2966468..2967364 | + | 897 | WP_002354953.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 43 a.a. Molecular weight: 4742.66 Da Isoelectric Point: 7.0058
>T124110 WP_002386265.1 NZ_CP039548:c2962368-2962240 [Enterococcus faecalis]
MHFNERSIFLSIEAALELMISFAAFVALLIFGILEATKNNKK
MHFNERSIFLSIEAALELMISFAAFVALLIFGILEATKNNKK
Download Length: 129 bp
>T124110 NZ_CP039548:c2962368-2962240 [Enterococcus faecalis]
ATGCACTTTAACGAAAGGAGCATTTTTTTGTCAATCGAAGCGGCATTGGAATTGATGATTAGTTTTGCAGCGTTTGTTGC
ACTACTGATTTTCGGTATCCTTGAAGCAACGAAAAACAATAAAAAATAA
ATGCACTTTAACGAAAGGAGCATTTTTTTGTCAATCGAAGCGGCATTGGAATTGATGATTAGTTTTGCAGCGTTTGTTGC
ACTACTGATTTTCGGTATCCTTGAAGCAACGAAAAACAATAAAAAATAA
Antitoxin
Download Length: 208 bp
>AT124110 NZ_CP039548:2962084-2962291 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTAT
TTTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTAT
TTTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|