Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 1008484..1008733 | Replicon | chromosome |
Accession | NZ_CP033114 | ||
Organism | Staphylococcus aureus strain ST20130945 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | SAST45_RS04765 | Protein ID | WP_000623369.1 |
Coordinates | 1008484..1008591 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF2 | ||
Locus tag | - | ||
Coordinates | 1008586..1008733 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
SAST45_RS04740 | 1005157..1005726 | - | 570 | WP_000287265.1 | competence protein ComK | - |
SAST45_RS04745 | 1005936..1006154 | + | 219 | WP_000876825.1 | IDEAL domain-containing protein | - |
SAST45_RS04750 | 1006235..1007221 | - | 987 | WP_000668820.1 | lipoate--protein ligase | - |
SAST45_RS04755 | 1007420..1007596 | + | 177 | WP_000214898.1 | YkvS family protein | - |
SAST45_RS04760 | 1007611..1008213 | + | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
SAST45_RS04765 | 1008484..1008591 | + | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
- | 1008586..1008733 | - | 148 | - | - | Antitoxin |
SAST45_RS04770 | 1009130..1009231 | + | 102 | WP_001790623.1 | hypothetical protein | - |
SAST45_RS04775 | 1009241..1009513 | + | 273 | WP_001794574.1 | lactococcin 972 family bacteriocin | - |
SAST45_RS04780 | 1009557..1011521 | + | 1965 | WP_000870819.1 | bacteriocin-associated integral membrane family protein | - |
SAST45_RS04785 | 1011524..1011844 | + | 321 | WP_000873929.1 | YxeA family protein | - |
SAST45_RS04790 | 1011841..1012482 | + | 642 | WP_000571191.1 | ABC transporter ATP-binding protein | - |
SAST45_RS04795 | 1012570..1012860 | - | 291 | WP_001791476.1 | hypothetical protein | - |
SAST45_RS04800 | 1013201..1013488 | + | 288 | WP_000410718.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T113207 WP_000623369.1 NZ_CP033114:1008484-1008591 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
>T113207 NZ_CP033114:1008484-1008591 [Staphylococcus aureus]
GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
Antitoxin
Download Length: 148 bp
>AT113207 NZ_CP033114:c1008733-1008586 [Staphylococcus aureus]
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|