Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 259979..260231 | Replicon | chromosome |
| Accession | NZ_CP030042 | ||
| Organism | Enterococcus faecalis strain C25 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | DOU31_RS01275 | Protein ID | WP_002393909.1 |
| Coordinates | 259979..260107 (+) | Length | 43 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 260052..260231 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DOU31_RS01255 | 255227..255625 | + | 399 | WP_002354951.1 | glyoxalase | - |
| DOU31_RS01255 | 255227..255625 | + | 399 | WP_002354951.1 | glyoxalase | - |
| DOU31_RS01260 | 255676..256572 | - | 897 | WP_002354953.1 | YitT family protein | - |
| DOU31_RS01260 | 255676..256572 | - | 897 | WP_002354953.1 | YitT family protein | - |
| DOU31_RS01265 | 256875..257375 | - | 501 | WP_002365352.1 | cysteine hydrolase | - |
| DOU31_RS01265 | 256875..257375 | - | 501 | WP_002365352.1 | cysteine hydrolase | - |
| DOU31_RS01270 | 257546..259816 | + | 2271 | WP_002398160.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| DOU31_RS01270 | 257546..259816 | + | 2271 | WP_002398160.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| DOU31_RS01275 | 259979..260107 | + | 129 | WP_002393909.1 | hypothetical protein | Toxin |
| DOU31_RS01275 | 259979..260107 | + | 129 | WP_002393909.1 | hypothetical protein | Toxin |
| - | 260052..260231 | - | 180 | - | - | Antitoxin |
| DOU31_RS01280 | 260413..260540 | + | 128 | Protein_225 | putative holin-like toxin | - |
| DOU31_RS01280 | 260413..260540 | + | 128 | Protein_225 | putative holin-like toxin | - |
| DOU31_RS01285 | 260725..261177 | - | 453 | WP_002354958.1 | YueI family protein | - |
| DOU31_RS01285 | 260725..261177 | - | 453 | WP_002354958.1 | YueI family protein | - |
| DOU31_RS01290 | 261362..262309 | + | 948 | WP_010716775.1 | iron chelate uptake ABC transporter family permease subunit | - |
| DOU31_RS01290 | 261362..262309 | + | 948 | WP_010716775.1 | iron chelate uptake ABC transporter family permease subunit | - |
| DOU31_RS01295 | 262306..263271 | + | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| DOU31_RS01295 | 262306..263271 | + | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| DOU31_RS01300 | 263268..264023 | + | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| DOU31_RS01300 | 263268..264023 | + | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| DOU31_RS01305 | 264062..265015 | + | 954 | WP_002375576.1 | siderophore ABC transporter substrate-binding protein | - |
| DOU31_RS01305 | 264062..265015 | + | 954 | WP_002375576.1 | siderophore ABC transporter substrate-binding protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 43 a.a. Molecular weight: 4743.64 Da Isoelectric Point: 5.6470
>T106910 WP_002393909.1 NZ_CP030042:259979-260107 [Enterococcus faecalis]
MHFNERSIFLSIEAALELMISFAAFVALLIFGILEATKNDKK
MHFNERSIFLSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 129 bp
>T106910 NZ_CP030042:259979-260107 [Enterococcus faecalis]
ATGCACTTTAACGAAAGGAGCATTTTTTTGTCAATCGAAGCGGCATTGGAATTGATGATTAGTTTTGCAGCGTTTGTTGC
ACTACTGATTTTCGGTATCCTTGAAGCAACGAAAAACGATAAAAAATAA
ATGCACTTTAACGAAAGGAGCATTTTTTTGTCAATCGAAGCGGCATTGGAATTGATGATTAGTTTTGCAGCGTTTGTTGC
ACTACTGATTTTCGGTATCCTTGAAGCAACGAAAAACGATAAAAAATAA
Antitoxin
Download Length: 180 bp
>AT106910 NZ_CP030042:c260231-260052 [Enterococcus faecalis]
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAGTGCAACAA
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAGTGCAACAA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|