Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | AapD-IsoD/- |
| Location | 964735..964802 | Replicon | chromosome |
| Accession | NC_000915 | ||
| Organism | Helicobacter pylori 26695 | ||
| T1TAdb ID | TA03830 | ||
Toxin (Protein)
| Gene name | AapD | Uniprot ID | - |
| Locus tag | - | Protein ID | - |
| Coordinates | 964735..964770 (-) | Length | 12 a.a. |
Antitoxin (RNA)
| Gene name | IsoD | ||
| Locus tag | - | ||
| Coordinates | 964751..964802 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| HP_RS04440 (HP0909) | 960890..961495 | + | 606 | WP_000613266.1 | hypothetical protein | - |
| HP_RS04440 (HP0909) | 960890..961495 | + | 606 | WP_000613266.1 | hypothetical protein | - |
| HP_RS04440 (HP0909) | 960890..961495 | + | 606 | WP_000613266.1 | hypothetical protein | - |
| HP_RS04440 (HP0909) | 960890..961495 | + | 606 | WP_000613266.1 | hypothetical protein | - |
| HP_RS04445 (HP0910) | 961476..962627 | + | 1152 | WP_000427118.1 | class I SAM-dependent methyltransferase | - |
| HP_RS04445 (HP0910) | 961476..962627 | + | 1152 | WP_000427118.1 | class I SAM-dependent methyltransferase | - |
| HP_RS04445 (HP0910) | 961476..962627 | + | 1152 | WP_000427118.1 | class I SAM-dependent methyltransferase | - |
| HP_RS04445 (HP0910) | 961476..962627 | + | 1152 | WP_000427118.1 | class I SAM-dependent methyltransferase | - |
| HP_RS04450 (HP0911) | 962631..964658 | + | 2028 | WP_000894570.1 | ATP-dependent helicase | - |
| HP_RS04450 (HP0911) | 962631..964658 | + | 2028 | WP_000894570.1 | ATP-dependent helicase | - |
| HP_RS04450 (HP0911) | 962631..964658 | + | 2028 | WP_000894570.1 | ATP-dependent helicase | - |
| HP_RS04450 (HP0911) | 962631..964658 | + | 2028 | WP_000894570.1 | ATP-dependent helicase | - |
| - | 964735..964770 | - | 36 | - | - | Toxin |
| - | 964751..964802 | + | 52 | - | - | Antitoxin |
| HP_RS04455 (HP0912) | 965177..966724 | + | 1548 | WP_000592437.1 | Hop family adhesin AlpA | - |
| HP_RS04455 (HP0912) | 965177..966724 | + | 1548 | WP_000592437.1 | Hop family adhesin AlpA | - |
| HP_RS04455 (HP0912) | 965177..966724 | + | 1548 | WP_000592437.1 | Hop family adhesin AlpA | - |
| HP_RS04455 (HP0912) | 965177..966724 | + | 1548 | WP_000592437.1 | Hop family adhesin AlpA | - |
| HP_RS04460 (HP0913) | 966746..968335 | + | 1590 | WP_000812546.1 | Hop family adhesin AlpB | - |
| HP_RS04460 (HP0913) | 966746..968335 | + | 1590 | WP_000812546.1 | Hop family adhesin AlpB | - |
| HP_RS04460 (HP0913) | 966746..968335 | + | 1590 | WP_000812546.1 | Hop family adhesin AlpB | - |
| HP_RS04460 (HP0913) | 966746..968335 | + | 1590 | WP_000812546.1 | Hop family adhesin AlpB | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 12 a.a. Molecular weight: 1291.66 Da Isoelectric Point: 8.7571
>T10216 - NC_000915:c964770-964735 [Helicobacter pylori 26695]
MKLLLVTTPLY
MKLLLVTTPLY
Download Length: 36 bp
>T10216 NC_000915:c964770-964735 [Helicobacter pylori 26695]
ATGAAGTTATTATTAGTAACAACGCCATTATACTAA
ATGAAGTTATTATTAGTAACAACGCCATTATACTAA
Antitoxin
Download Length: 52 bp
>AT10216 NC_000915:964751-964802 [Helicobacter pylori 26695]
GTTACTAATAATAACTTCATAGTTGGTTATCTCCTTTCGGGGTAACCACCCA
GTTACTAATAATAACTTCATAGTTGGTTATCTCCTTTCGGGGTAACCACCCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
References
(1) Cynthia M Sharma et al. (2010) The primary transcriptome of the major human pathogen Helicobacter pylori. Nature 464(7286):250-5. [PubMed:20164839]