Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 1926750..1926999 | Replicon | chromosome |
Accession | NZ_CP028190 | ||
Organism | Staphylococcus aureus strain CFSAN018749 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | C9J86_RS09925 | Protein ID | WP_000623369.1 |
Coordinates | 1926750..1926857 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF2 | ||
Locus tag | - | ||
Coordinates | 1926852..1926999 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
C9J86_RS09900 | 1923423..1923992 | - | 570 | WP_000287265.1 | competence protein ComK | - |
C9J86_RS09905 | 1924202..1924420 | + | 219 | WP_000876825.1 | IDEAL domain-containing protein | - |
C9J86_RS09910 | 1924501..1925487 | - | 987 | WP_000668820.1 | lipoate--protein ligase | - |
C9J86_RS09915 | 1925686..1925862 | + | 177 | WP_000214898.1 | YkvS family protein | - |
C9J86_RS09920 | 1925877..1926479 | + | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
C9J86_RS09925 | 1926750..1926857 | + | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
- | 1926852..1926999 | - | 148 | - | - | Antitoxin |
C9J86_RS09930 | 1927396..1927497 | + | 102 | WP_001790623.1 | hypothetical protein | - |
C9J86_RS09935 | 1927507..1927779 | + | 273 | WP_001794574.1 | lactococcin 972 family bacteriocin | - |
C9J86_RS09940 | 1927823..1929787 | + | 1965 | WP_053865698.1 | bacteriocin-associated integral membrane family protein | - |
C9J86_RS09945 | 1929790..1930110 | + | 321 | WP_000873929.1 | YxeA family protein | - |
C9J86_RS09950 | 1930107..1930748 | + | 642 | WP_000571183.1 | ABC transporter ATP-binding protein | - |
C9J86_RS09955 | 1930836..1931126 | - | 291 | WP_001791476.1 | hypothetical protein | - |
C9J86_RS09960 | 1931467..1931754 | + | 288 | WP_000410718.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T100809 WP_000623369.1 NZ_CP028190:1926750-1926857 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
>T100809 NZ_CP028190:1926750-1926857 [Staphylococcus aureus]
GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
Antitoxin
Download Length: 148 bp
>AT100809 NZ_CP028190:c1926999-1926852 [Staphylococcus aureus]
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|