Detailed information    

insolico Bioinformatically predicted

Overview

Name   comS   Type   Regulator
Locus tag   - Genome accession   NZ_KB373319
Coordinates   32225..32320 (+) Length   32 a.a.
NCBI ID   - Uniprot ID   -
Organism   Streptococcus urinalis FB127-CNA-2     
Function   activate transcription of comX; activate transcription of comS (predicted from homology)   
Competence regulation

Genomic Context

Location: 27225..37320
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  HMPREF9318_RS07915 (HMPREF9318_01592) purE 27386..27874 (+) 489 WP_006738645.1 5-(carboxyamino)imidazole ribonucleotide mutase -
  HMPREF9318_RS07920 (HMPREF9318_01593) purK 27861..28934 (+) 1074 WP_006740048.1 5-(carboxyamino)imidazole ribonucleotide synthase -
  HMPREF9318_RS07925 (HMPREF9318_01594) - 28955..29560 (+) 606 WP_006739379.1 hypothetical protein -
  HMPREF9318_RS07930 (HMPREF9318_01595) purB 29769..31064 (+) 1296 WP_006740705.1 adenylosuccinate lyase -
  HMPREF9318_RS07935 (HMPREF9318_01596) - 31181..32110 (+) 930 Protein_28 helix-turn-helix domain-containing protein -
  HMPREF9318_RS12035 (HMPREF9318_01597) - 32225..32323 (+) 99 WP_006740706.1 quorum-sensing system DWW-type pheromone -
  HMPREF9318_RS07940 (HMPREF9318_01598) ruvB 32353..33351 (+) 999 WP_006740129.1 Holliday junction branch migration DNA helicase RuvB -
  HMPREF9318_RS07945 (HMPREF9318_01599) - 33609..34058 (+) 450 WP_006738715.1 low molecular weight protein-tyrosine-phosphatase -
  HMPREF9318_RS07950 (HMPREF9318_01600) - 34076..34456 (+) 381 WP_196792584.1 hypothetical protein -
  HMPREF9318_RS07955 (HMPREF9318_01601) - 34453..36231 (+) 1779 WP_006739776.1 acyltransferase family protein -

Sequence

Protein


Download         Length: 32 a.a.        Molecular weight: 3771.62 Da        Isoelectric Point: 10.0079

>NTDB_id=568 32225..32320(+) (comS) [Streptococcus urinalis FB127-CNA-2]
MNKKFSILLLLMLPFISTAIKYASEIDWWKIG

Nucleotide


Download         Length: 96 bp        

>NTDB_id=568 32225..32320(+) (comS) [Streptococcus urinalis FB127-CNA-2]
ATGAACAAAAAATTTTCTATCTTACTACTTTTAATGCTTCCTTTTATTTCAACTGCTATTAAGTATGCGTCTGAAATAGA
TTGGTGGAAAATTGGA

XIP

This gene is known to encode the precursor of σX inducing peptide (XIP), which involves in competence development. The mature XIP sequence is displayed as below:

IDWWKIG


Domains


No domain identified.



Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value