 ICEberg ID | 244_IME |
Name  | Tn5520  |
| Family | - |
| Organism | Bacteroides fragilis LV23 |
| Size (bp) | 4692 bp |
| GC content [Genome] (%) | |
| Insertion site | AT-rich regions |
| Function | - |
| Species that IME can be transferred to | - |
| Nucleotide Sequence | AF038866.2 (complete IME sequence in this GenBank file) |
| Replicon | - |
| Coordinates | 1..4692 |
| Putative oriT region | coordinates: 2321..2391; oriTDB id: 200007 GAAAATACCGTAGCTTATTAGGGAATTTTCCGAGCCGCAATACTCCGTATCGCTGAAAATTCCCCAATAA G |
| Putative relaxase | coordinates: 2496..3863; Gene: bmpH; Family: MOBV |
The Interaction Network among ICE/IME/CIME/plasmid | ||||||
 | ||||||
| Detailed Informatioin of the Interaction Network | ||||||
| # | IME | Inter_Ele [Type] | Methods | Donors | Recipients | Exper_Ref |
| 1 | Tn5520 | R751 [IncP plasmid] | in trans | Escherichia coli | Escherichia coli | 10198023 |
| This is an interactioin derived from experimental literature |
The graph information of Tn5520 components from AF038866 | |||||
 | |||||
| Complete gene list of Tn5520 from AF038866 | |||||
| # | Gene | Coordinates [+/-], size (bp) | Product | *Reannotation | |
| 1 | bipH | 268..1500 [+], 1233 | transposase | Integrase | |
| 2 | bmpH | 2496..3863 [+], 1368 | mobilization protein BmpH | Relaxase | |
 Gene may contribute to site-specific recombination |
 Gene may play role in conjugative transfer |
| (1) Guedon G; Libante V; Coluzzi C; Payot S; Leblond-Bourget N (2017). The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 8(11). [PudMed:29165361] |
| (2) Bellanger X; Payot S; Leblond-Bourget N; Guedon G (2014). Conjugative and mobilizable genomic islands in bacteria: evolution and diversity. FEMS Microbiol Rev. 38(4):720-60. [PudMed:24372381] |
| (3) Bass KA; Hecht DW (2002). Isolation and characterization of cLV25, a Bacteroides fragilis chromosomal transfer factor resembling multiple Bacteroides sp. mobilizable transposons. J Bacteriol. 184(7):1895-904. [PudMed:11889096] |
| (4) Vedantam G; Novicki TJ; Hecht DW (1999). Bacteroides fragilis transfer factor Tn5520: the smallest bacterial mobilizable transposon containing single integrase and mobilization genes that function in Escherichia coli. J Bacteriol. 181(8):2564-71. [PudMed:10198023] |