ICEberg
I. Information of IME
ICEberg ID244_IME
Name Tn5520 This IME is derived from experimental literature
Family-
OrganismBacteroides fragilis LV23
Size (bp)4692 bp
GC content [Genome] (%)
Insertion siteAT-rich regions
Function-
Species that IME can be transferred to-
Nucleotide SequenceAF038866.2 (complete IME sequence in this GenBank file)
Replicon-
Coordinates1..4692
Putative oriT region coordinates: 2321..2391;   oriTDB id:  200007
GAAAATACCGTAGCTTATTAGGGAATTTTCCGAGCCGCAATACTCCGTATCGCTGAAAATTCCCCAATAA
G
Putative relaxase coordinates: 2496..3863; Gene: bmpH;  Family:  MOBV


II. IME interaction with ICE/CIME/Plasmids

The Interaction Network among ICE/IME/CIME/plasmid


Detailed Informatioin of the Interaction Network
# IME  Inter_Ele [Type] Methods Donors Recipients Exper_Ref 
1Tn5520 R751 [IncP plasmid] experimentalin trans Escherichia coli Escherichia coli 10198023

experimental This is an interactioin derived from experimental literature


The graph information of Tn5520 components from AF038866
Complete gene list of Tn5520 from AF038866
#GeneCoordinates [+/-], size (bp) Product *Reannotation 
1bipH268..1500 [+], 1233transposaseIntegrase 
2bmpH2496..3863 [+], 1368mobilization protein BmpHRelaxase 
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins2Fasta
(1) Guedon G; Libante V; Coluzzi C; Payot S; Leblond-Bourget N (2017). The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 8(11). [PudMed:29165361]
(2) Bellanger X; Payot S; Leblond-Bourget N; Guedon G (2014). Conjugative and mobilizable genomic islands in bacteria: evolution and diversity. FEMS Microbiol Rev. 38(4):720-60. [PudMed:24372381]
(3) Bass KA; Hecht DW (2002). Isolation and characterization of cLV25, a Bacteroides fragilis chromosomal transfer factor resembling multiple Bacteroides sp. mobilizable transposons. J Bacteriol. 184(7):1895-904. [PudMed:11889096]
(4) Vedantam G; Novicki TJ; Hecht DW (1999). Bacteroides fragilis transfer factor Tn5520: the smallest bacterial mobilizable transposon containing single integrase and mobilization genes that function in Escherichia coli. J Bacteriol. 181(8):2564-71. [PudMed:10198023]
 

Genomics & Bioinformatics Group in MML, SJTU