ICEberg
I. Information of IME
ICEberg ID194_IME
Name NBU2  This IME is derived from experimental literature
Family-
OrganismBacteroides fragilis
Size (bp)11123 bp
GC content [Genome] (%)
Insertion site3′ of two tRNASer genes
FunctionlinA2N2 (lincosamide resistance)
Species that IME can be transferred to-
Nucleotide SequenceAF251288 (complete IME sequence in this GenBank file)
Replicon-
Coordinates1..11123
Putative oriT region coordinates: 8812..9030;   oriTDB id:  200011
TCCGCATGGAATACGGCAGAGAGCGGTACATCCGGGACGCTTCGCAGATTTACAGAGGATGCAAGGACTT
GAACGAATACTTACAGAAACAGATTGAAAGAAAAAGGCAGCTCCAGTCCGCCAAAGGGGTGCGCAGCCAA
TCACCGGAAAAGAAGAACGGCTTCCAGTTATAGCCCACTATAACTACACGCTTCGCTTTCGTAGTTGTGG
GCTCTCCCG
Putative relaxase coordinates: 9137..10543; Gene: mobN2;  Family:  -


II. IME interaction with ICE/CIME/Plasmids

The Interaction Network among ICE/IME/CIME/plasmid


Detailed Informatioin of the Interaction Network
# IME  Inter_Ele [Type] Methods Donors Recipients Exper_Ref 
1NBU2  CTnERL [ICE] experimentalin trans Bacteroides fragilis; Bacteroides uniformis; Bacteroides thetaiotaomicron Bacteroides thetaiotaomicron 5482; Bacteroides uniformis; Escherichia coli 8407835; 7608064; 10852890
2NBU2  RP4 [IncP plasmid] experimentalin trans Escherichia coli E. coli HB101 7608064
3NBU2  R751 [IncP plasmid] experimentalin trans Escherichia coli E. coli HB101 7608064
4NBU2  CTnDOT [ICE] experimentalin trans Bacteroides thetaiotaomicron; Bacteroides uniformis Bacteroides thetaiotaomicron 5482 8407835

experimental This is an interactioin derived from experimental literature


The graph information of NBU2  components from AF251288
Complete gene list of NBU2  from AF251288
#GeneCoordinates [+/-], size (bp) Product *Reannotation 
1linAn2258..770 [-], 513lincomycin resistance gene
2mefEn2795..2000 [-], 1206MefEn2
3intN22499..3782 [+], 1284integraseIntegrase 
4-3846..6194 [+], 2349unknown
5-6736..7815 [+], 1080unknown
6prmN28028..8984 [+], 957PrmN2
7mobN29137..10543 [+], 1407mobilization proteinRelaxase 
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins7Fasta
(1) Guedon G; Libante V; Coluzzi C; Payot S; Leblond-Bourget N (2017). The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 8(11). [PudMed:29165361]
(2) Bellanger X; Payot S; Leblond-Bourget N; Guedon G (2014). Conjugative and mobilizable genomic islands in bacteria: evolution and diversity. FEMS Microbiol Rev. 38(4):720-60. [PudMed:24372381]
(3) Bass KA; Hecht DW (2002). Isolation and characterization of cLV25, a Bacteroides fragilis chromosomal transfer factor resembling multiple Bacteroides sp. mobilizable transposons. J Bacteriol. 184(7):1895-904. [PudMed:11889096]
(4) Wang J; Shoemaker NB; Wang GR; Salyers AA (2000). Characterization of a Bacteroides mobilizable transposon, NBU2, which carries a functional lincomycin resistance gene. J Bacteriol. 182(12):3559-71. [PudMed:10852890]
 

Genomics & Bioinformatics Group in MML, SJTU