 ICEberg ID | 194_IME |
Name  | NBU2  |
| Family | - |
| Organism | Bacteroides fragilis |
| Size (bp) | 11123 bp |
| GC content [Genome] (%) | |
| Insertion site | 3′ of two tRNASer genes |
| Function | linA2N2 (lincosamide resistance) |
| Species that IME can be transferred to | - |
| Nucleotide Sequence | AF251288 (complete IME sequence in this GenBank file) |
| Replicon | - |
| Coordinates | 1..11123 |
| Putative oriT region | coordinates: 8812..9030; oriTDB id: 200011 TCCGCATGGAATACGGCAGAGAGCGGTACATCCGGGACGCTTCGCAGATTTACAGAGGATGCAAGGACTT GAACGAATACTTACAGAAACAGATTGAAAGAAAAAGGCAGCTCCAGTCCGCCAAAGGGGTGCGCAGCCAA TCACCGGAAAAGAAGAACGGCTTCCAGTTATAGCCCACTATAACTACACGCTTCGCTTTCGTAGTTGTGG GCTCTCCCG |
| Putative relaxase | coordinates: 9137..10543; Gene: mobN2; Family: - |
The Interaction Network among ICE/IME/CIME/plasmid | ||||||
 | ||||||
| Detailed Informatioin of the Interaction Network | ||||||
| # | IME | Inter_Ele [Type] | Methods | Donors | Recipients | Exper_Ref |
| 1 | NBU2 | CTnERL [ICE] | in trans | Bacteroides fragilis; Bacteroides uniformis; Bacteroides thetaiotaomicron | Bacteroides thetaiotaomicron 5482; Bacteroides uniformis; Escherichia coli | 8407835; 7608064; 10852890 |
| 2 | NBU2 | RP4 [IncP plasmid] | in trans | Escherichia coli | E. coli HB101 | 7608064 |
| 3 | NBU2 | R751 [IncP plasmid] | in trans | Escherichia coli | E. coli HB101 | 7608064 |
| 4 | NBU2 | CTnDOT [ICE] | in trans | Bacteroides thetaiotaomicron; Bacteroides uniformis | Bacteroides thetaiotaomicron 5482 | 8407835 |
| This is an interactioin derived from experimental literature |
The graph information of NBU2 components from AF251288 | |||||
 | |||||
| Complete gene list of NBU2 from AF251288 | |||||
| # | Gene | Coordinates [+/-], size (bp) | Product | *Reannotation | |
| 1 | linAn2 | 258..770 [-], 513 | lincomycin resistance gene | ||
| 2 | mefEn2 | 795..2000 [-], 1206 | MefEn2 | ||
| 3 | intN2 | 2499..3782 [+], 1284 | integrase | Integrase | |
| 4 | - | 3846..6194 [+], 2349 | unknown | ||
| 5 | - | 6736..7815 [+], 1080 | unknown | ||
| 6 | prmN2 | 8028..8984 [+], 957 | PrmN2 | ||
| 7 | mobN2 | 9137..10543 [+], 1407 | mobilization protein | Relaxase | |
 Gene may contribute to site-specific recombination |
 Gene may play role in conjugative transfer |
| (1) Guedon G; Libante V; Coluzzi C; Payot S; Leblond-Bourget N (2017). The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 8(11). [PudMed:29165361] |
| (2) Bellanger X; Payot S; Leblond-Bourget N; Guedon G (2014). Conjugative and mobilizable genomic islands in bacteria: evolution and diversity. FEMS Microbiol Rev. 38(4):720-60. [PudMed:24372381] |
| (3) Bass KA; Hecht DW (2002). Isolation and characterization of cLV25, a Bacteroides fragilis chromosomal transfer factor resembling multiple Bacteroides sp. mobilizable transposons. J Bacteriol. 184(7):1895-904. [PudMed:11889096] |
| (4) Wang J; Shoemaker NB; Wang GR; Salyers AA (2000). Characterization of a Bacteroides mobilizable transposon, NBU2, which carries a functional lincomycin resistance gene. J Bacteriol. 182(12):3559-71. [PudMed:10852890] |