 ICEberg ID | 176_IME |
Name  | MGIVchMoz6  |
| Family | - |
| Organism | Vibrio cholerae 16AMOZ |
| Size (bp) | 19740 bp |
| GC content [Genome] (%) | |
| Insertion site | 3′ end of yicC |
| Function | aadA2 (streptomycin, spectinomycin), floR (chloramphenicol, florfenicol), tet(G) (tetracycline), blaPSE-1 (ampicillin), sul1 (sulfonamides), merEDAFPT (mercury) |
| Species that IME can be transferred to | - |
| Nucleotide Sequence | KC117175 (partical IME sequence) |
| Putative oriT region | coordinates: 5288..5391; oriTDB id: 200056 TTCCCCATGCCTTTACCCCCTTACGCCAAAACCACTATCCGTTTGGCTTTTGGATCGAAACGCCAAACAG GGAAATTAGCCCATTTACTGTTTGGCGTCTCGAT |
| Putative relaxase | - |
The Interaction Network among ICE/IME/CIME/plasmid | ||||||
 | ||||||
| Detailed Informatioin of the Interaction Network | ||||||
| # | IME | Inter_Ele [Type] | Methods | Donors | Recipients | Exper_Ref |
| 1 | MGIVchMoz6 | ICEVchMoz6 [ICE] | in trans | Vibrio cholerae | Escherichia coli | 23204461 |
| This is an interactioin derived from experimental literature |
The graph information of MGIVchMoz6 components from KC117175 | |||||
 | |||||
| Incomplete gene list of MGIVchMoz6 from KC117175 | |||||
| # | Gene | Coordinates [+/-], size (bp) | Product | *Reannotation | |
| 1 | int | 340..1590 [+], 1251 | integrase family tyrosine site-specific recombinase | Integrase | |
| 2 | MGIVCHMOZ6_002 | 1592..1930 [+], 339 | conserved hypothetical protein | ||
| 3 | MGIVCHMOZ6_003 | 2126..2428 [+], 303 | conserved hypothetical protein | ||
| 4 | MGIVCHMOZ6_004 | 2460..2831 [+], 372 | helix-turn-helix domain-containing protein | ||
| 5 | MGIVCHMOZ6_005 | 2857..5265 [+], 2409 | DEAD/DEAH box helicase | ||
| 6 | MGIVCHMOZ6_006 | 5723..6382 [+], 660 | conserved hypothetical protein | ||
| 7 | MGIVCHMOZ6_007 | 6379..7581 [-], 1203 | hypothetical protein | ||
| 8 | MGIVCHMOZ6_008 | 7591..7875 [-], 285 | hypothetical protein | ||
| 9 | MGIVCHMOZ6_009 | 7953..10559 [-], 2607 | hypothetical protein | ||
| 10 | MGIVCHMOZ6_010 | 10645..12570 [-], 1926 | hypothetical protein | ||
| 11 | MGIVCHMOZ6_011 | 12557..13819 [-], 1263 | type II restriction-modification system methylation subunit | ||
| 12 | MGIVCHMOZ6_012 | 13809..14141 [-], 333 | putative transcriptional regulator | ||
| 13 | MGIVCHMOZ6_013 | 14705..15015 [-], 311 | hypothetical protein | ||
| 14 | MGIVCHMOZ6_014 | 15116..15531 [-], 416 | hypothetical protein | ||
| 15 | rdfM | 15518..15760 [-], 243 | recombination directionality factor | ||
| 16 | MGIVCHMOZ6_016 | 16239..16553 [+], 315 | helix-turn-helix domain transcriptional regulator | ||
| 17 | MGIVCHMOZ6_017 | 16873..18222 [-], 1350 | HipA domain-containing protein | ||
| 18 | MGIVCHMOZ6_018 | 18212..18535 [-], 324 | helix-turn-helix domain transcriptional regulator | ||
 Gene may contribute to site-specific recombination |
| (1) Guedon G; Libante V; Coluzzi C; Payot S; Leblond-Bourget N (2017). The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 8(11). [PudMed:29165361] |
(2) Daccord A; Ceccarelli D; Rodrigue S; Burrus V (2013). Comparative analysis of mobilizable genomic islands. J Bacteriol. 195(3):606-14. [PudMed:23204461] 
|
|
(3) Taviani E; Ceccarelli D; Lazaro N; Bani S; Cappuccinelli P; Colwell RR; Colombo MM (2008). Environmental Vibrio spp., isolated in Mozambique, contain a polymorphic group of integrative conjugative elements and class 1 integrons. FEMS Microbiol Ecol. 64(1):45-54. [PudMed:18318712]
|
| experimental literature |
| in silico analysis literature |