ICEberg
I. Information of IME
ICEberg ID176_IME
Name MGIVchMoz6 This IME is derived from experimental literature
Family-
OrganismVibrio cholerae 16AMOZ
Size (bp)19740 bp
GC content [Genome] (%)
Insertion site3′ end of yicC
FunctionaadA2 (streptomycin, spectinomycin), floR (chloramphenicol, florfenicol), tet(G) (tetracycline), blaPSE-1 (ampicillin), sul1 (sulfonamides), merEDAFPT (mercury)
Species that IME can be transferred to-
Nucleotide SequenceKC117175 (partical IME sequence)
Putative oriT region coordinates: 5288..5391;   oriTDB id:  200056
TTCCCCATGCCTTTACCCCCTTACGCCAAAACCACTATCCGTTTGGCTTTTGGATCGAAACGCCAAACAG
GGAAATTAGCCCATTTACTGTTTGGCGTCTCGAT
Putative relaxase -


II. IME interaction with ICE/CIME/Plasmids

The Interaction Network among ICE/IME/CIME/plasmid


Detailed Informatioin of the Interaction Network
# IME  Inter_Ele [Type] Methods Donors Recipients Exper_Ref 
1MGIVchMoz6 ICEVchMoz6 [ICE] experimentalin trans Vibrio cholerae Escherichia coli 23204461

experimental This is an interactioin derived from experimental literature


The graph information of MGIVchMoz6 components from KC117175
Incomplete gene list of MGIVchMoz6 from KC117175
#GeneCoordinates [+/-], size (bp) Product *Reannotation 
1int340..1590 [+], 1251integrase family tyrosine site-specific recombinaseIntegrase 
2MGIVCHMOZ6_0021592..1930 [+], 339conserved hypothetical protein
3MGIVCHMOZ6_0032126..2428 [+], 303conserved hypothetical protein
4MGIVCHMOZ6_0042460..2831 [+], 372helix-turn-helix domain-containing protein
5MGIVCHMOZ6_0052857..5265 [+], 2409DEAD/DEAH box helicase
6MGIVCHMOZ6_0065723..6382 [+], 660conserved hypothetical protein
7MGIVCHMOZ6_0076379..7581 [-], 1203hypothetical protein
8MGIVCHMOZ6_0087591..7875 [-], 285hypothetical protein
9MGIVCHMOZ6_0097953..10559 [-], 2607hypothetical protein
10MGIVCHMOZ6_01010645..12570 [-], 1926hypothetical protein
11MGIVCHMOZ6_01112557..13819 [-], 1263type II restriction-modification system methylation subunit
12MGIVCHMOZ6_01213809..14141 [-], 333putative transcriptional regulator
13MGIVCHMOZ6_01314705..15015 [-], 311hypothetical protein
14MGIVCHMOZ6_01415116..15531 [-], 416hypothetical protein
15rdfM15518..15760 [-], 243recombination directionality factor
16MGIVCHMOZ6_01616239..16553 [+], 315helix-turn-helix domain transcriptional regulator
17MGIVCHMOZ6_01716873..18222 [-], 1350HipA domain-containing protein
18MGIVCHMOZ6_01818212..18535 [-], 324helix-turn-helix domain transcriptional regulator
 
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins18Fasta
(1) Guedon G; Libante V; Coluzzi C; Payot S; Leblond-Bourget N (2017). The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 8(11). [PudMed:29165361]
(2) Daccord A; Ceccarelli D; Rodrigue S; Burrus V (2013). Comparative analysis of mobilizable genomic islands. J Bacteriol. 195(3):606-14. [PudMed:23204461] experimental in_silico
(3) Taviani E; Ceccarelli D; Lazaro N; Bani S; Cappuccinelli P; Colwell RR; Colombo MM (2008). Environmental Vibrio spp., isolated in Mozambique, contain a polymorphic group of integrative conjugative elements and class 1 integrons. FEMS Microbiol Ecol. 64(1):45-54. [PudMed:18318712] experimental
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU