ICEberg
I. Information of IME
ICEberg ID172_IME
Name MGIVchHai6 This IME is derived from experimental literature
Family-
OrganismVibrio non-O1/non-O139 cholerae HC-36A1
Size (bp)47437 bp
GC content [Genome] (%)
Insertion sitetrmE
Functionβ-lactams, sulfamethoxazole, tetracycline, chloramphenicol, trimethoprim, streptomycin/spectinomycin and mercury resistance
Species that IME can be transferred toEnterobacteriaceae
Nucleotide SequenceAXDR01000001 (complete IME sequence in this contig)
Replicon-
Coordinates43098..91582
Putative oriT region coordinates: 85940..85988;   oriTDB id:  200079
TCCAAGATCCCCCATCAGATAGTTATTGGAAAGGAATTGGTAGGGTCTT
Putative relaxase coordinates: 85145..85939; Gene: MobI;  Family:  Other


II. IME interaction with ICE/CIME/Plasmids

The Interaction Network among ICE/IME/CIME/plasmid


Detailed Informatioin of the Interaction Network
# IME  Inter_Ele [Type] Methods Donors Recipients Exper_Ref 
1MGIVchHai6 pVCR94 [IncA/C plasmid] experimentalin trans Vibrio cholerae HC-36A1; Escherichia coli Escherichia coli 27435459

experimental This is an interactioin derived from experimental literature


The graph information of MGIVchHai6 components from AXDR01000001
Complete gene list of MGIVchHai6 from AXDR01000001
#GeneCoordinates [+/-], size (bp) Product *Reannotation 
1VCHC36A1_004039040..39375 [+], 336DNA binding, excisionase family domain protein
2VCHC36A1_004139818..41401 [+], 1584hypothetical protein
3VCHC36A1_004241455..42630 [-], 1176phage integrase family protein
4VCHC36A1_004343098..43940 [+], 843hypothetical protein
5VCHC36A1_004444355..44516 [+], 162hypothetical protein
6VCHC36A1_004544530..44943 [+], 414hypothetical protein
7VCHC36A1_004645077..45559 [+], 483resolvase, N terminal domain protein
8merR45587..45724 [-], 138mercuric resistance operon regulatory protein
9merP46487..46765 [+], 279mercuric transport protein periplasmic component
10merA46952..48661 [+], 1710mercuric reductase
11VCHC36A1_005049330..49755 [-], 426resolvase, N terminal domain protein
12VCHC36A1_005150005..51222 [-], 1218tniQ family protein
13VCHC36A1_005251219..52073 [-], 855bacterial TniB family protein
14VCHC36A1_005352130..53812 [-], 1683integrase core domain protein
15VCHC36A1_005454590..55603 [-], 1014integron integrase family proteinIntegrase 
16VCHC36A1_005555749..56540 [+], 792nucleotidyltransferase domain proteinAR 
17VCHC36A1_005657045..57884 [+], 840dihydropteroate synthase
18VCHC36A1_005758289..59830 [+], 1542transposase family protein
19VCHC36A1_005860096..60593 [+], 498hypothetical protein
20VCHC36A1_005961651..62622 [+], 972dihydropteroate synthaseAR 
21VCHC36A1_006062839..64053 [+], 1215drug resistance transporter, Bcr/CflA subfamily proteinAR 
22tetR64260..64886 [-], 627tetracycline repressor protein class D
23tetA64990..66165 [+], 1176tetracycline resistance protein, class CAR 
24VCHC36A1_006366186..66977 [+], 792bacterial regulatory helix-turn-helix, lysR family protein
25VCHC36A1_006467069..67476 [-], 408transposase
26VCHC36A1_006567492..67656 [+], 165putative transposase
27VCHC36A1_006667700..68563 [-], 864putative transposase
28VCHC36A1_006768515..68673 [+], 159hypothetical protein
29VCHC36A1_006868828..69226 [-], 39960 kDa chaperonin domain protein
30intI169245..69391 [+], 147class 1 integrase domain protein
31pse469687..70553 [+], 867beta-lactamase PSE-4AR 
32VCHC36A1_007171111..71950 [+], 840dihydropteroate synthaseAR 
33VCHC36A1_007272164..72889 [+], 726hypothetical protein
34VCHC36A1_007372884..72997 [-], 114NTP-binding protein
35VCHC36A1_007473010..73831 [-], 822transposase
36VCHC36A1_007573891..74295 [+], 405resolvease/recombinase
37VCHC36A1_007674484..74714 [+], 231transcriptional regulator
38VCHC36A1_007774711..76210 [+], 1500N-6 DNA Methylase family protein
39VCHC36A1_007876207..76836 [+], 630hypothetical protein
40VCHC36A1_007976829..78295 [+], 1467divergent AAA domain protein
41VCHC36A1_008078292..79794 [+], 1503N-6 DNA Methylase family protein
42VCHC36A1_008179795..80934 [+], 1140type I restriction modification DNA specificity domain protein
43hsdR80940..84002 [+], 3063type I site-specific deoxyribonuclease, HsdR family protein
44VCHC36A1_008384053..85087 [+], 1035putative DNA-binding protein
45VCHC36A1_008485145..85939 [-], 795hypothetical proteinRelaxase 
46VCHC36A1_008586351..86548 [+], 198DNA binding, excisionase family domain protein
47VCHC36A1_008686561..88237 [+], 1677hypothetical protein
48VCHC36A1_008788299..88643 [+], 345DNA binding, excisionase family domain protein
49VCHC36A1_008888888..90057 [-], 1170phage integrase family protein
50trmE90221..91582 [-], 1362tRNA modification GTPase TrmE
51oxaA91676..93301 [-], 1626inner membrane protein oxaA
52rnpA93528..93851 [-], 324ribonuclease P protein component
53rpmH93897..94034 [-], 138ribosomal protein L34
54VCHC36A1_009394276..95013 [-], 738ABC transporter family protein
55yxeN95010..95681 [-], 672putative amino-acid permease protein yxeN
56yxeM95759..96505 [-], 747putative amino-acid-binding protein yxeM
 
flank Flanking regions
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins47Fasta
(1) Rivard N; Colwell RR; Burrus V (2020). Antibiotic Resistance in Vibrio cholera: Mechanistic Insights from Inc Plasmid-Mediated Dissemination of a Novel Family of Genomic Islands Inserted at trmE. mSphere. 5(4) : e00748-20. [PudMed:32848007]
(2) Guedon G; Libante V; Coluzzi C; Payot S; Leblond-Bourget N (2017). The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 8(11). [PudMed:29165361]
(3) Carraro N; Rivard N; Burrus V; Ceccarelli D (2017). Mobilizable genomic islands, different strategies for the dissemination of multidrug resistance and other adaptive traits. Mob Genet Elements. 7(2):1-6. [PudMed:28439449]
(4) Carraro N; Rivard N; Ceccarelli D; Colwell RR; Burrus V (2016). IncA/C Conjugative Plasmids Mobilize a New Family of Multidrug Resistance Islands in Clinical Vibrio cholerae Non-O1/Non-O139 Isolates from Haiti. MBio. 7(4). [PudMed:27435459]
 

Genomics & Bioinformatics Group in MML, SJTU