TCCAAGATCCCCCATCAGATAGTTATTGGAAAGGAATTGGTAGGGTCTT
[1] Carraro N et al (2016) IncA/C Conjugative Plasmids Mobilize a New Family of Multidrug Resistance Islands in Clinical Vibrio cholerae Non-O1/Non-O139 Isolates from Haiti. mBio. 7(4):e00509-16. [PMID:27435459] |
[2] Rivard N et al (2020) Antibiotic Resistance in Vibrio cholerae: Mechanistic Insights from IncC Plasmid-Mediated Dissemination of a Novel Family of Genomic Islands Inserted at trmE. mSphere. 5(4):e00748-20. [PMID:32848007] |