ICEberg
I. Information of ICE
ICEberg ID961
Name ICEAplThis ICE is derived from experimental literature
ICEO ID ICEO_0000144
OrganismActinobacillus pleuropneumoniae serovar 8
Size (bp)92660
GC content [Genome] (%)46.94
Insertion siteprfC
FunctionAntibiotic resistance genes: floR, strAB, sul2 and dfrA1
Species that ICE can be transferred toActinobacillus pleuropneumoniae
Nucleotide SequenceMF187965 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..92660 
Putative oriT region coordinates: 6516..6622;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 38193..40343; Locus tag: ICEApl2.36;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEApl2 is not available.



The graph information of ICEApl2 components from MF187965
Complete gene list of ICEApl2 from MF187965
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1yhaH3..470 [-], 468YhaH
2ICEApl2.011175..1363 [+], 189DNA-binding protein
3ICEApl2.021590..3527 [+], 1938hypothetical protein
4intS3657..4898 [-], 1242hypothetical proteinIntegrase 
5ICEApl2.044900..5169 [-], 270hypothetical protein
6ICEApl2.055172..6146 [-], 975rod shape determination protein
7ICEApl2.066242..6409 [+], 168hypothetical protein
8ICEApl2.076611..7054 [+], 444hypothetical protein
9ICEApl2.087065..8237 [-], 1173hypothetical protein
10ICEApl2.098521..9114 [+], 594hypothetical protein
11tnp9228..10724 [+], 1497hypothetical protein
12ICEApl2.1110866..12206 [+], 1341hypothetical protein
13ICEApl2.1212321..12512 [+], 192RepA protein
14ICEApl2.1414147..15031 [+], 885T4SS protein
15floR15248..16462 [+], 1215hypothetical proteinAR 
16ICEApl2.1616490..16795 [+], 306putative transcriptional regulator
17tnpA16907..17446 [+], 540hypothetical protein
18strB17418..18254 [-], 837hypothetical proteinAR 
19strA18254..19057 [-], 804hypothetical proteinAR 
20sul219118..19933 [-], 816hypothetical proteinAR 
21ICEApl2.2120404..22017 [+], 1614transposase Tn3 family protein
22ICEApl2.2222360..22668 [-], 309DNA polymerase V subunit UmuC
23lexA_122637..23086 [-], 450LexA repressor
24polC23725..24630 [+], 906PolC-type DNA polymerase III
25ICEApl2.2524718..25017 [+], 300hypothetical protein
26ICEApl2.2625339..26289 [+], 951hypothetical protein
27hsdM26298..28013 [+], 1716type I restriction enzyme EcoKI M protein
28ICEApl2.2828006..28710 [+], 705hypothetical protein
29ICEApl2.2928707..29861 [+], 1155BstXI restriction endonuclease
30hsdR_129866..33030 [+], 3165type I restriction enzyme EcoR124II R protein
31mcrB33046..35244 [+], 21995-methylcytosine-specific restriction enzyme B
32ICEApl2.3235244..36371 [+], 1128hypothetical protein
33mrr36371..37225 [+], 855Mrr restriction system protein
34ICEApl2.3437319..37600 [+], 282hypothetical protein
35ICEApl2.3537600..38073 [+], 474hypothetical protein
36ICEApl2.3638193..40343 [+], 2151putative helicaseRelaxase, MOBH Family
37ICEApl2.3740392..42212 [+], 1821AAA-like domain proteinTraD_F, T4SS component 
38ICEApl2.3842222..42782 [+], 561hypothetical protein
39ICEApl2.3942769..43404 [+], 636hypothetical protein
40ICEApl2.4043431..44018 [-], 588replicative DNA helicase
41ICEApl2.4144307..44588 [+], 282TraL proteinTraL_F, T4SS component 
42ICEApl2.4244585..45211 [+], 627TraE proteinTraE_F, T4SS component 
43ICEApl2.4345192..46091 [+], 900TraK proteinTraK_F, T4SS component 
44ICEApl2.4446094..47383 [+], 1290bacterial conjugation TrbI-like proteinTraB_F, T4SS component 
45ICEApl2.4547458..48030 [+], 573hypothetical proteinTraV_F, T4SS component 
46ICEApl2.4648027..48413 [+], 387hypothetical proteinTraA_F, T4SS component 
47ICEApl2.4748592..49425 [+], 834hypothetical protein
48ICEApl2.4849418..50356 [+], 939hypothetical protein
49dsbC_150488..51180 [+], 693thiol:disulfide interchange protein DsbCTrbB_I, T4SS component 
50ICEApl2.5051180..53579 [+], 2400AAA-like domain proteinTraC_F, T4SS component 
51ICEApl2.5153572..53919 [+], 348hypothetical protein
52ICEApl2.5253903..54415 [+], 513peptidase S26TraF, T4SS component 
53ICEApl2.5354426..55550 [+], 1125hypothetical proteinTraW_F, T4SS component 
54ICEApl2.5455534..56562 [+], 1029TraU proteinTraU_F, T4SS component 
55ICEApl2.5556565..60257 [+], 3693hypothetical proteinTraN_F, T4SS component 
56dnaI60594..61349 [-], 756primosomal protein DnaI
57ICEApl2.5761361..62881 [-], 1521integrase core domain protein
58ICEApl2.5863333..66698 [-], 3366ski2-like helicase
59ICEApl2.5966685..67560 [-], 876hypothetical protein
60endA67832..68515 [-], 684endonuclease-1 precursor
61ICEApl2.6168624..69226 [-], 603hypothetical protein
62ICEApl2.6269596..69922 [+], 327hypothetical protein
63ssb_269938..70357 [+], 420single-stranded DNA-binding protein
64ICEApl2.6470437..71255 [+], 819RecT family
65ICEApl2.6571339..71482 [+], 144hypothetical protein
66ICEApl2.6671543..72559 [+], 1017YqaJ-like viral recombinase domain
67cobS72769..73728 [+], 960aerobic cobaltochelatase subunit CobS
68ICEApl2.6873728..74495 [+], 768hypothetical protein
69ICEApl2.6974594..75547 [+], 954hypothetical protein
70ICEApl2.7075609..76049 [+], 441hypothetical protein
71ICEApl2.7176119..77774 [+], 1656cobalamin biosynthesis protein CobT
72ICEApl2.7277858..78355 [+], 498hypothetical protein
73ICEApl2.7378355..78696 [+], 342hypothetical protein
74ICEApl2.7478788..79861 [+], 1074primase-helicase zinc-binding domain
75ICEApl2.7579951..80658 [+], 708hypothetical protein
76dhfrI80964..81437 [+], 474dihydrofolate reductase type 1AR 
77ICEApl2.7781550..81912 [+], 363hypothetical protein
78ICEApl2.7882007..82420 [+], 414hypothetical protein
79ICEApl2.7982667..83611 [+], 945hypothetical proteinTraF_F, T4SS component 
80ICEApl2.8083614..85002 [+], 1389hypothetical proteinTraH_F, T4SS component 
81ICEApl2.8185006..88575 [+], 3570TraG-like proteinTraG_F, T4SS component 
82ICEApl2.8288608..89039 [-], 432hypothetical protein
83flhC89097..89630 [-], 534flagellar transcriptional regulator FlhC
84ICEApl2.8489627..89926 [-], 300transcriptional activator FlhD
85ICEApl2.8589923..90471 [-], 549transglycosylase SLT domain proteinOrf169_F, T4SS component 
86ICEApl2.8690458..91120 [-], 663hypothetical protein
87ICEApl2.8791107..91976 [-], 870hypothetical protein
88ICEApl2.8892032..92283 [-], 252hypothetical protein
89ICEApl2.8992401..93048 [+], 648hypothetical protein
90prfC93305..94894 [+], 1590PrfC
 
flank Flanking regions

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins88Fasta
(1) Li Y; Li Y; Fernandez Crespo R; Leanse LG; Langford PR; Bosse JT (2018). Characterization of the Actinobacillus pleuropneumoniae SXT-related integrative and conjugative element ICEApl2 and analysis of the encoded FloR protein: hydrophobic residues in transmembrane domains contribute dynamically to florfenicol and chloramphenicol efflux. J Antimicrob Chemother. 73(1):57-65. [PubMed:29029160]